This site uses cookies.
Some of these cookies are essential to the operation of the site,
while others help to improve your experience by providing insights into how the site is being used.
For more information, please see the ProZ.com privacy policy.
Freelance translator and/or interpreter, Verified site user
Data security
This person has a SecurePRO™ card. Because this person is not a ProZ.com Plus subscriber, to view his or her SecurePRO™ card you must be a ProZ.com Business member or Plus subscriber.
Affiliations
This person is not affiliated with any business or Blue Board record at ProZ.com.
Rates per language pair: English to Spanish - Standard rate: 0.08 USD per word / 25 USD per hour Spanish to English - Standard rate: 0.08 USD per word / 25 USD per hour
English to Spanish: Process for the biological production of n-Butanol with high yield General field: Law/Patents Detailed field: Genetics
Source text - English Process for the biological production of n-Butanol with high yield
FIELD OF INVENTION
The invention comprises a process for the bioconversion of a fermentable carbon source to n-butanol at high yield by a metabolically engineered microorganism.
BACKGROUND OF THE INVENTION
n-Butanol is a colorless, neutral liquid of medium volatility with restricted miscibility (about 7-8%) in water, but freely miscible with all common solvents such as glycols, ketones, alcohol, aldehydes, ethers, and aromatic and aliphatic hydrocarbons. n-Butanol is used i) to make other chemicals, ii) as a solvent and iii) as an ingredient in formulated products such as cosmetics. The major uses of n-butanol as a feed-stock are in the synthesis of acrylate/methacrylate esters, glycol ethers, n-Butyl acetate, amino resins and n-Butylamines. Currently more than 9 millions tons of n-Butanol are consumed annually in the world.
More recently it has been shown that n-butanol is a better biofuel than ethanol due to lower vapour pressure, higher energy content (closer to that of gasoline) and lesser susceptibility to separation in the presence of water. Furthermore, n-butanol can be blended at higher concentrations than ethanol for use in standard vehicle engines and it does not require automakers to compromise on performance to meet environmental regulations; it is also suitable for transport in pipelines and as a result it has the potential to be introduced into gasoline quickly and avoid the need for additional large-scale supply infrastructures.
n-butanol can be produced as an acetone/n-butanol/ethanol (ABE) mixture by the fermentation of carbohydrate by solventogenic Clostridia. The ABE fermentations are biphasic. During the first acidogenic phase, high growth rate is accompanied by acetic and butyric acids production. In the second solventogenic phase growth rate decrease and the solvents (ABE) are produced with the concomitant consumption of the organic acids produced in the first phase. Carbon dioxide and hydrogen are produced throughout the fermentation.
The biological production of n-butanol, presented in figure 1, requires the formation of butyryl-CoA as an intermediate which can be reduced, depending on the physiological conditions, by two different bi-functional aldehyde-alcohol dehydrogenases encoded by adhE1 and adhE2. Butyryl-CoA can also be converted to butyric acid by a phospho-transbutyrylase and a butyrate kinase encoded respectively by the ptb and buk genes. Acetone is produced from aceto-acetyl-CoA (an intermediate in the production of butyryl-CoA) by a CoA-transferase and an acetoacetate decarboxylase encoded respectively by the ctfAB and adc genes. Hydrogen is produced by an iron only hydrogenase encoded by the hydA gene. When cultures are performed in the presence of carbon monoxide, a hydrogenase inhibitor, n-butanol, ethanol and lactate are the main fermentation products. Lactate is produced from pyruvate by a lactate dehydrogenase encoded by the ldh gene.
Clostridium acetobutylicum strains with an inactivated buk gene (obtained by single crossing over with a non-replicable plasmid) have already been described in the article (Green et al., 1996). The non-replicable vector pJC4BK, with a 0.8 kb internal buk fragment was integrated into the chromosomal buk gene which leaded to an inactivation of the endogenous gene. The obtained strain was named “mutant PJC4BK”from the name of the plasmid. As precised in this article, this gene integration did not completely eliminate enzyme activity nor butyrate formation due to the instability of this type of gene inactivation that can reverse to wild type by plasmid excision. This mutant strain was then used in several studies (Green and Bennett, 1998; Desai and Harris, 1999; Harris et al., 2000).
Traditionally, the commercial ABE fermentation was conducted only in a batch mode due to continuous cultures instability of the producing Clostridia. Several solvent yielding fermentation processes have been described. These processes yield n-butanol, acetone and ethanol in a ratio of 6:3:1. Solvent yields of 29-34% (18-25% for n-butanol only) of fermentable carbon source have been reported in the literature. A total solvent concentration of 16-24 g/l and a n-butanol concentration of 10-14 g/l is generally the limit due to toxicity of n-butanol produced. However, these low titers of solvent no longer seem to be an economical limitation to the process as it has recently been demonstrated that solvents can be recovered during fermentation by the use of the “low cost” gas striping technology.
The problem to be solved by the present invention is to obtain a stable mutant strain with no butyrate kinase activity , that could be cultureD for several generations without any possibility of reversion to the wild type genotype. This strain would be useful for the biological production of n-butanol at high yield, from an inexpensive carbon substrate such as glucose or other sugars, by genetically stable cultures of Clostridia. The number of biochemical steps to inactivate and the complexity of the regulation of the metabolism necessitate, for an industrial feasible process of n-butanol production, the use of a metabolically engineered whole cell catalyst.
SUMMARY OF THE INVENTION
Applicants have solved the stated problem and the present invention provides a method for bioconverting a fermentable carbon source to n-butanol as a major product by genetically stable cultures of Clostridia. Glucose is used as a model substrate and recombinant Clostridium acetobutylicum is used as the model host. In one aspect of this invention, a stable recombinant C. acetobutylicum unable to metabolize butyryl-CoA to butyrate is constructed by deleting the gene coding for the butyrate kinase (buk). In another aspect of this invention, a recombinant C. acetobutylicum unable to produce acetone is constructed by deleting the genes coding for the CoA-transferase (ctfAB). In a further aspect of this invention a recombinant strain unable to produce lactate is constructed by deleting the gene coding for the lactate dehydrogenase (ldh). Furthermore, a recombinant C. acetobutylicum unable to produce acetate is constructed by deleting the genes coding for the phosphotransacetylase and/or acetate kinase (pta and ack). In a final aspect of this invention, the flux of hydrogen production is decreased and then the flux of reducing equivalent redirected toward n-butanol production by attenuating the gene encoding the hydrogenase (hydA).
The present invention may be generally applied to include any carbon substrate that is readily converted to acetyl-coA.
Accordingly it is an object of the present invention to provide a recombinant organism, useful for the production of n-butanol comprising: (a) at least deletion of one of the two genes involved in the conversion of butyryl-CoA to butyrate and (b) at least deletion of one of the two genes encoding the CoA-transferase activity. Optionally the recombinant organism may comprise i) inactivating mutations in endogenous genes selected from the group consisting of: (a) a gene encoding a polypeptide having lactate dehydrogenase activity (b) a gene encoding a polypeptide having phospho-transacetylase or actate kinase activity and ii) attenuation in a gene encoding a polypeptide having hydrogenase activity.
In another embodiment the invention provides a stable process for the production of n-butanol at high yield from a recombinant organism comprising: (a) contacting the recombinant organism of the present invention with at least one carbon source selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, and single carbon substrates whereby n-butanol is produced; optionally (b) recovering the n-butanol during the production through a step of gas striping and (c) purifying n-butanol from the condensate by distillation.
BRIEF DESCRIPTION OF THE DRAWINGS
The accompanying drawing which is incorporated in and constitutes a part of this specification exemplifies the invention and together with the description, serve to explain the principles of this invention.
Figure 1 depicts the genetic engineering of central metabolism in the development of a butanol production system from carbohydrates.
1 : Pyruvate-ferredoxin oxydoreductase ; 2 : Thiolase ; 3 : -Hydroxybutyryl-CoA dehydrogenase ; 4 : Crotonase ; 5 : Butyryl-CoA dehydrogenase ; 6 : Lactate dehydrogenase ; 7 : Phospho-transacetylase ; 8 : Acetate kinase ; 9 : Acetaldehyde deshydrogenase ; 10 : Ethanol dehydrogenase ; 11 : CoA transférase (Acetoacetyl-CoA :acetate/butyrate : CoA transferase) ; 12 : Acetoacetate decarboxylase ; 13 : Phospho-transbutyrylase ; 14 : Butyrate kinase ; 15 : Butyraldehyde-Butanol dehydrogenase ; 16 : hydrogenase.
DETAILED DESCRIPTION OF THE INVENTION
As used herein the following terms may be used for interpretation of the claims and specification.
The term “microorganism” refers to all kind of unicellular organisms, including prokaryotic organisms like bacteria, and eukaryotic organisms like yeasts.
The expression “appropriate culture medium” refers to a culture medium adapted for the used microorganism as it is well known by the man skilled in the art.
The term "carbon substrate" or "source of carbon" means any carbon source capable of being metabolized by a microorganism wherein the substrate contains at least one carbon atom. In particular it may be glucose, sucrose, mono- or oligosaccharides, starch or its derivatives, glycerol, and their mixtures thereof.
The term “attenuation” refers to a decreased expression of a gene or a decreased activity of the protein, product of the gene. The man skilled in the art knows numerous means to obtain this result, and for example:
- Introduction of a mutation into the gene, decreasing the expression level of this gene, or the level of activity of the encoded protein.
- Replacement of the natural promoter of the gene by a low strength promoter, resulting in a lower expression.
- Use of elements destabilizing the corresponding messenger RNA or the protein.
- Deletion of the gene if no expression is needed.
The term “deleted gene” means that a substantial part of the coding sequences of said gene was removed. Preferably, at least 50% of the coding sequence was removed, and more preferably at least 80%.
In the description of the present invention, enzymes are identified by their specific activities. This definition thus includes all polypeptides that have the defined specific activity also present in other organisms, more particularly in other microorganisms. Often enzymes with similar activities can be identified by their grouping to certain families defined as PFAM or COG.
PFAM (protein families database of alignments and hidden Markov models; http://www.sanger.ac.uk/Software/Pfam/) represents a large collection of protein sequence alignments. Each PFAM makes it possible to visualize multiple alignments, see protein domains, evaluate distribution among organisms, gain access to other databases, and visualize known protein structures.
COGs (clusters of orthologous groups of proteins; http://www.ncbi.nlm.nih.gov/COG/) are obtained by comparing protein sequences from 43 fully sequenced genomes representing 30 major phylogenic lines. Each COG is defined from at least three lines, which permits the identification of former conserved domains.
The means of identifying homologous sequences and their percentage homologies are well known to those skilled in the art, and include in particular the BLAST programs, which can be used from the website http://www.ncbi.nlm.nih.gov/BLAST/ with the default parameters indicated on that website. The sequences obtained can then be exploited (e.g., aligned) using, for example, the programs CLUSTALW (http://www.ebi.ac.uk/clustalw/) or MULTALIN (http://prodes.toulouse.inra.fr/multalin/cgi-bin/multalin.pl), with the default parameters indicated on those websites
Using the references given on GenBank for known genes, those skilled in the art are able to determine the equivalent genes in other organisms, bacterial strains, yeasts, fungi, mammals, plants, etc. This routine work is advantageously done using consensus sequences that can be determined by carrying out sequence alignments with genes derived from other microorganisms, and designing degenerate probes to clone the corresponding gene in another organism. These routine methods of molecular biology are well known to those skilled in the art, and are described, for example, in Sambrook et al. (Molecular Cloning: a Laboratory Manual. 2nd ed. Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1989.).
The present invention provides a method for the fermentative batch or continuous production of n-butanol by culturing a microorganism in an appropriate culture medium comprising a carbon source and the simultaneous recovery of n-butanol from the culture medium wherein at least one gene involved in butyrate formation is deleted in the microorganism.
A specific embodiment of the invention provides a method wherein the microorganism is modified to be unable to convert butyryl-CoA to butyrate due to the deletion of at least one gene encoding for phospho-transbutyrylase (ptb) or butyrate kinase (buk). Deletion of genes in Clostridia can be done using the method recently described in patent application PCT/EP2006/066997 allowing the i) replacement of the gene to delete with an erythromycin resistance gene and ii) removal of the erythromycin resistance gene with a recombinase.
In another embodiment of the invention, the microorganism is unable to produce acetone due to an attenuation or a deletion of at least one of the gene involved in acetone formation. Preferably, this gene is encoding for the enzyme CoA-transferase (ctfAB) or acetoacetate decarboxylase (adc). Deletion of one of these genes can be done using the method recently described in patent application PCT/EP2006/066997.
In a further embodiment of the invention, the microorganism used in the method of the invention is unable to produce lactate. In particular this can be due to a deletion of the gene ldh encoding for lactate dehydrogenase. Deletion of ldh can be done using the method recently described in patent application PCT/EP2006/066997.
In another embodiment, the microorganism is modified in such a way to be unable to produce acetate. This result can be achieved by deletion of at least one involved in acetate formation. Preferably this gene is selected among the group consisting of the genes encoding for phospho-transacetylase (pta) or acetate kinase (ack). Deletion of one of these genes can be done using the method recently described in patent application PCT/EP2006/066997.
An embodiment of the invention also provides a microorganism with a decreased flux of hydrogen production and then a redirection of the flux of reducing equivalent toward n-butanol production; this can be done by attenuating the gene encoding the hydrogenase (hydA), an enzyme that provides a sink for reducing equivalent in the form of hydrogen production. Attenuation of hydA can be done by replacing the natural promoter by a low strength promoter or by element destabilizing the corresponding messenger RNA or the protein. If needed, complete attenuation of the gene can also be achieved by a deletion of the corresponding DNA sequence.
Preferably, the used microorganism is selected among the group consisting of C. acetobutylicum, C. beijerinckii, C. saccharoperbutylacetonicum or C. saccharobutylicum.
In another embodiment of the invention, the culture is continuous and stable.
In another embodiment, the method according to the invention comprises the following steps:
(a) contacting a microorganism with at least one carbon source selected from the group consisting of glucose, xylose, arabinose, sucrose, monosaccharides, oligosaccharides, polysaccharides, cellulose, xylan, starch or its derivatives and glycerol, whereby n-butanol is produced
(b) Recovering the n-butanol during the fermentation by gas striping and
(c) Isolation of n-butanol from the condensate by distillation.
Those skilled in the art are able to define the culture conditions for the microorganisms according to the invention. In particular the clostridia are fermented at a temperature between 20°C and 55°C, preferentially between 25°C and 40°C, and more specifically about 35°C for C. acetobutylicum.
The fermentation is generally conducted in fermentors with an inorganic culture medium of known defined composition adapted to the bacteria used, containing at least one simple carbon source, and if necessary a co-substrate necessary for the production of the metabolite.
The invention is also related to the microorganism as described previously. Preferably, this microorganism is selected among the group consisting of C. acetobutylicum, C. beijerinckii, C. saccharoperbutylacetonicum or C. saccharobutylicum.
EXAMPLE 1
Construction of strains unable to produce butyrate: Clostridium acetobutylicum Δcac1515 Δupp Δbuk
To delete the buk gene, the homologous recombination strategy described by Croux & Soucaille (2006) in patent application PCT/EP2006/066997 is used. This strategy allows the insertion of an erythromycin resistance cassette, while deleting most of the gene concerned. The buk deletion cassette in pCons::upp was constructed as follows.
Table 1 : primers sequences
Name Primer sequences
Buk 1 SEQ ID N°1 aaaaggatcctagtaaaagggagtgtacgaccagtg
Buk 2 SEQ ID N°2 ggggtcgcgaaaaaaggggggattattagtaatctatacatgttaacattcctccac
Buk 3 SEQ ID N°3 cccccttttttcgcgaccccacttcttgcacttgcagaaggtggac
Buk 4 SEQ ID N°4 aaaaggatcctctaaattctgcaatatatgccccccc
Buk 0 SEQ ID N°5 ataacaggatatatgctctctgacgcgg
Buk 5 SEQ ID N°6 gatcatcactcattttaaacatggggcc
Two DNA fragments surrounding buk were PCR amplified with the Pwo polymerase with total DNA from C. acetobutylicum as template and two specific couples of olignonucleotides. With the couples of primers BUK 1-BUK 2 and BUK 3–BUK 4, two DNA fragments were respectively obtained. Both primers BUK 1 and BUK 4 introduce a BamHI site while primers BUK 2 and BUK 3 have a complementary region which introduces a NruI site. DNA fragments BUK 1-BUK 2 and BUK 3–BUK 4 were joined in a PCR fusion experiment with primers BUK 1 and BUK 4 and the resulting fragment was cloned in pCR4-TOPO-Blunt to yield pTOPO :buk. At the unique StuI site of pTOPO :buk, an antibiotic resistance MLS gene with FRT sequences on both sides was introduced from the StuI fragment of pUC18-FRT-MLS2. The BUK deletion cassette obtained after BamHI digestion of the resulting plasmid was cloned into pCons::upp at the BamHI site to yield the pREPBUK::upp plasmid.
The pREPBUK::upp plasmid was used to transform by electroporation C. acetobutylicum MGCcac15upp strain. After selection on Petri plate for clones resistant to erythromycin (40 µg/ml), one colony was cultured for 24 hours in liquid synthetic medium with erythromycin at 40 µg/ml and 100 l of undiluted culture was plated on RCA with erythromycin at 40 µg/ml and 5-FU at 400 µM. Colonies resistant to both erythromycin and 5-FU were replica plated on both RCA with erythromycin at 40 µg/ml and RCA with thiamphenicol at 50 µg/ml to select clones where 5-FU resistance is also associated with thiamphenicol sensitivity. The genotype of clones resistant to erythromycin and sensitive to thiamphenicol was checked by PCR analysis (with primers BUK 0 and BUK 5 located outside of the buk deletion cassette). The cac15uppbuk::mlsR strain which have lost pREPbuk::upp was isolated.
The cac15uppbuk::mlsR strain was transformed with pCLF1.1 vector expressing the Flp1 gene encoding the Flp recombinase from S. cerevisiae. After transformation and selection for resistance to thiamphenicol (50 µg/ml) on Petri plate, one colony was cultured on synthetic liquid medium with thiamphenicol at 50 µg/ml and appropriate dilutions were plated on RCA with thiamphenicol at 50 µg/ml. Thiamphenicol resistant clones were replica plated on both RCA with erythromycin at 40 µg/ml and RCA with thiamphenicol at 50 µg/ml. The genotype of clones with erythromycin sensitivity and thiamphenicol resistance was checked by PCR analysis with primers BUK 0 and BUK 5. Two successive 24 hours cultures of the cac15uppbuk strain with erythromycin sensitivity and thiamphenicol resistance were carried out in order to lose pCLF1.1. The cac15uppbuk strain which has lost pCLF1.1 was isolated according to its sensitivity to both erythromycin and thiamphenicol.
EXAMPLE 2
Construction of strains unable to produce butyrate and acetone: C. acetobutylicum Δcac1515 Δupp Δbuk ΔctfAB
To delete the ctfAB genes, the homologous recombination strategy described by Croux & Soucaille (2006) in patent application PCT/EP2006/066997 is used. This strategy allows the insertion of an erythromycin resistance cassette, while deleting most of the genes concerned. The ctfAB deletion cassette in pCons::upp was constructed as follows.
Table 2 : primers sequences
Name Primer sequences
Ctf 1 SEQ ID N°7 aaaaggatcccagacactataatagctttaggtggtacccc
Ctf 2 SEQ ID N°8 ggggaggcctaaaaagggggattataaaaagtagttgaaatatgaaggtttaaggttg
Ctf 3 SEQ ID N°9 ccccctttttaggcctccccatatccaatgaacttagacccatggctg
Ctf 4 SEQ ID N°10 aaaaggatccgtgttataatgtaaatataaataaataggactagaggcg
Ctf 0 SEQ ID N°11 taccaccttctttcacgcttggctgcgg
Ctf 5 SEQ ID N°12 tatttaaagaggcattatcaccagagcg
Two DNA fragments surrounding ctfAB were PCR amplified with the Pwo polymerase with total DNA from C. acetobutylicum as template and two specific couples of olignonucleotides. With the couples of primers CTF 1-CTF 2 and CTF 3–CTF 4, two DNA fragments were respectively obtained. Both primers CTF 1 and CTF 4 introduce a BamHI site while primers CTF 2 and CTF 3 have a complementary region which introduces a StuI site. DNA fragments CTF 1-CTF 2 and CTF 3–CTF 4 were joined in a PCR fusion experiment with primers CTF 1 and CTF 4 and the resulting fragment was cloned in pCR4-TOPO-Blunt to yield pTOPO :CTF. At the unique StuI site of pTOPO :CTF, an antibiotic resistance MLS gene with FRT sequences on both sides was introduced from the StuI fragment of pUC18-FRT-MLS2. The UPP deletion cassette obtained after BamHI digestion of the resulting plasmid was cloned into pCons::upp at the BamHI site to yield the pREPCTF::upp plasmid.
The pREPCTF::upp plasmid was used to transform by electroporation C. acetobutylicum MGCcac15uppΔbuk strain. After selection on Petri plate for clones resistant to erythromycin (40 µg/ml), one colony was cultured for 24 hours in liquid synthetic medium with erythromycin at 40 µg/ml and 100 l of undiluted culture was plated on RCA with erythromycin at 40 µg/ml and 5-FU at 400 µM. Colonies resistant to both erythromycin and 5-FU were replica plated on both RCA with erythromycin at 40 µg/ml and RCA with thiamphenicol at 50 µg/ml to select clones where 5-FU resistance is also associated with thiamphenicol sensitivity. The genotype of clones resistant to erythromycin and sensitive to thiamphenicol was checked by PCR analysis (with primers CTF 0 and CTF 5 located outside of the ctfAB deletion cassette). The cac15uppbuk ΔctfAB::mlsR strain which have lost pREPCTF::upp was isolated.
The cac15uppbukΔctfAB::mlsR strain was transformed with pCLF1.1 vector expressing the Flp1 gene encoding the Flp recombinase from S. cerevisiae. After transformation and selection for resistance to thiamphenicol (50 µg/ml) on Petri plate, one colony was cultured on synthetic liquid medium with thiamphenicol at 50 µg/ml and appropriate dilutions were plated on RCA with thiamphenicol at 50 µg/ml. Thiamphenicol resistant clones were replica plated on both RCA with erythromycin at 40 µg/ml and RCA with thiamphenicol at 50 µg/ml. The genotype of clones with erythromycin sensitivity and thiamphenicol resistance was checked by PCR analysis with primers CTF 0 and CTF 5. Two successive 24 hours cultures of the cac15uppbukΔctfAB strain with erythromycin sensitivity and thiamphenicol resistance were carried out in order to lose pCLF1.1. The cac15uppbukΔctfAB strain which has lost pCLF1.1 was isolated according to its sensitivity to both erythromycin and thiamphenicol.
EXAMPLE 3
Construction of strains unable to produce butyrate, acetone and lactate: C. acetobutylicum Δcac1515 Δupp Δbuk ΔctfAB Δldh
To delete the ldh gene, the homologous recombination strategy described by Croux & Soucaille (2006) in patent application PCT/EP2006/066997 is used. This strategy allows the insertion of an erythromycin resistance cassette, while deleting most of the genes concerned. The ldh deletion cassette in pCons::upp was constructed as follows.
Table 3 : primers sequences
Name Primer sequences
Ldh 1 SEQ ID N°13 AAAAGGATCCGCTTTAAAATTTGGAAAGAGGAAGTTGTG
Ldh 2 SEQ ID N°14 GGGGAGGCCTAAAAAGGGGGTTAGAAATCTTTAAAAATTTCTCTATAGAGCCCATC
Ldh 3 SEQ ID N°15 CCCCCTTTTTAGGCCTCCCCGGTAAAAGACCTAAACTCCAAGGGTGGAGGCTAGGTC
Ldh 4 SEQ ID N°16 AAAAGGATCCCCCATTGTGGAGAATATTCCAAAGAAGAAAATAATTGC
Ldh 0 SEQ ID N°17 CAGAAGGCAAGAATGTATTAAGCGGAAATGC
Ldh 5 SEQ ID N°18 CTTCCCATTATAGCTCTTATTCACATTAAGC
Two DNA fragments surrounding ldh (CAC267) were PCR amplified with the Pwo polymerase with total DNA from C. acetobutylicum as template and two specific couples of olignonucleotides. With the couples of primers LDH 1-LDH 2 and LDH 3–LDH 4, 1135 bp and 1177 bp DNA fragments were respectively obtained. Both primers LDH 1 and LDH 4 introduce a BamHI site while primers LDH 2 and LDH 3 have a complementary region which introduces a StuI site. DNA fragments LDH 1-LDH 2 and LDH 3–LDH 4 were joined in a PCR fusion experiment with primers LDH 1 and LDH 4 and the resulting fragment was cloned in pCR4-TOPO-Blunt to yield pTOPO :LDH. At the unique StuI site of pTOPO :LDH, an antibiotic resistance MLS gene with FRT sequences on both sides was introduced from the 1372 bp StuI fragment of pUC18-FRT-MLS2. The UPP deletion cassette obtained after BamHI digestion of the resulting plasmid was cloned into pCons::upp at the BamHI site to yield the pREPLDH::upp plasmid.
The pREPLDH::upp plasmid was used to transform by electroporation C. acetobutylicum MGCcac15uppΔbukΔctfAB strain. After selection on Petri plate for clones resistant to erythromycin (40 µg/ml), one colony was cultured for 24 hours in liquid synthetic medium with erythromycin at 40 µg/ml and 100 l of undiluted culture was plated on RCA with erythromycin at 40 µg/ml and 5-FU at 400 µM. Colonies resistant to both erythromycin and 5-FU were replica plated on both RCA with erythromycin at 40 µg/ml and RCA with thiamphenicol at 50 µg/ml to select clones where 5-FU resistance is also associated with thiamphenicol sensitivity. The genotype of clones resistant to erythromycin and sensitive to thiamphenicol was checked by PCR analysis (with primers LDH 0 and LDH 5 located outside of the ldh deletion cassette). The cac15uppbuk ΔctfAB Δldh::mlsR strain which have lost pREPLDH::upp was isolated.
The cac15uppbukΔctfABΔldh::mlsR strain was transformed with pCLF1.1 vector expressing the Flp1 gene encoding the Flp recombinase from S. cerevisiae. After transformation and selection for resistance to thiamphenicol (50 µg/ml) on Petri plate, one colony was cultured on synthetic liquid medium with thiamphenicol at 50 µg/ml and appropriate dilutions were plated on RCA with thiamphenicol at 50 µg/ml. Thiamphenicol resistant clones were replica plated on both RCA with erythromycin at 40 µg/ml and RCA with thiamphenicol at 50 µg/ml. The genotype of clones with erythromycin sensitivity and thiamphenicol resistance was checked by PCR analysis with primers LDH 0 and LDH 5. Two successive 24 hours cultures of the cac15uppbukΔctfAB Δldh strain with erythromycin sensitivity and thiamphenicol resistance were carried out in order to lose pCLF1.1. The cac15uppbukΔctfABΔldh strain which has lost pCLF1.1 was isolated according to its sensitivity to both erythromycin and thiamphenicol.
EXAMPLE 4
Construction of strains unable to produce butyrate, acetone, lactate and acetate: C. acetobutylicum Δcac1515 Δupp Δbuk ΔctfAB Δldh Δpta-ack
To delete the pta and ack genes, the homologous recombination strategy described by Croux & Soucaille (2006) in patent application PCT/EP2006/066997 is used. This strategy allows the insertion of an erythromycin resistance cassette, while deleting most of the genes concerned. The pta-ack deletion cassette in pCons::upp was constructed as follows.
Table 4 : primers sequences
Name Primer sequences
PA 1 SEQ ID N°19 aaaaggatcctattataacagtcaaacccaataaaatactggg
PA 2 SEQ ID N°20 ggggaggcctaaaaagggggttaatccatttgtattttctcccttcataatgcc
PA 3 SEQ ID N°21 ccccctttttaggcctcccctttattttgcatgcttatataataaattatggctgcg
PA 4 SEQ ID N°22 aaaaggatccgcttttccttcttttacaagatttaaagcc
PA 0 SEQ ID N°23 cacttttatttatcaagctgtaggcc
PA 5 SEQ ID N°24 tataccttttgaacctaggaaaggc
Two DNA fragments surrounding pta-ack were PCR amplified with the Pwo polymerase with total DNA from C. acetobutylicum as template and two specific couples of olignonucleotides. With the couples of primers PA 1-PA 2 and PA 3–PA 4, two DNA fragments were respectively obtained. Both primers PA 1 and PA 4 introduce a BamHI site while primers PA 2 and PA 3 have a complementary region which introduces a StuI site. DNA fragments PA 1-PA 2 and PA 3–PA 4 were joined in a PCR fusion experiment with primers PA 1 and PA 4 and the resulting fragment was cloned in pCR4-TOPO-Blunt to yield pTOPO :PA. At the unique StuI site of pTOPO :PA, an antibiotic resistance MLS gene with FRT sequences on both sides was introduced from the StuI fragment of pUC18-FRT-MLS2. The UPP deletion cassette obtained after BamHI digestion of the resulting plasmid was cloned into pCons::upp at the BamHI site to yield the pREPPA::upp plasmid.
The pREPPA::upp plasmid was used to transform by electroporation C. acetobutylicum MGCcac15uppΔbukΔctfABΔldh strain. After selection on Petri plate for clones resistant to erythromycin (40 µg/ml), one colony was cultured for 24 hours in liquid synthetic medium with erythromycin at 40 µg/ml and 100 l of undiluted culture was plated on RCA with erythromycin at 40 µg/ml and 5-FU at 400 µM. Colonies resistant to both erythromycin and 5-FU were replica plated on both RCA with erythromycin at 40 µg/ml and RCA with thiamphenicol at 50 µg/ml to select clones where 5-FU resistance is also associated with thiamphenicol sensitivity. The genotype of clones resistant to erythromycin and sensitive to thiamphenicol was checked by PCR analysis (with primers PA 0 and PA 5 located outside of the pta-ack deletion cassette). The cac15uppbuk ΔctfABΔldhΔpta-ack::mlsR strain which have lost pREPPA::upp was isolated.
The cac15uppbukΔctfABΔldh Δpta-ack::mlsR strain was transformed with pCLF1.1 vector expressing the Flp1 gene encoding the Flp recombinase from S. cerevisiae. After transformation and selection for resistance to thiamphenicol (50 µg/ml) on Petri plate, one colony was cultured on synthetic liquid medium with thiamphenicol at 50 µg/ml and appropriate dilutions were plated on RCA with thiamphenicol at 50 µg/ml. Thiamphenicol resistant clones were replica plated on both RCA with erythromycin at 40 µg/ml and RCA with thiamphenicol at 50 µg/ml. The genotype of clones with erythromycin sensitivity and thiamphenicol resistance was checked by PCR analysis with primers PA 0 and PA 5. Two successive 24 hours cultures of the cac15uppbukΔctfABΔldhΔpta-ack strain with erythromycin sensitivity and thiamphenicol resistance were carried out in order to lose pCLF1.1. The cac15uppbukΔctfABΔldhΔpta-ack strain which has lost pCLF1.1 was isolated according to its sensitivity to both erythromycin and thiamphenicol.
EXAMPLE 5
Construction of strains with lower hydrogen production: C. acetobutylicum Δcac1515 Δupp Δbuk ΔctfAB Δldh ΔhydA
To delete the hydA gene, the homologous recombination strategy described by Croux & Soucaille (2006) in patent application PCT/EP2006/066997 is used. This strategy allows the insertion of an erythromycin resistance cassette, while deleting most of the genes concerned. The hydA deletion cassette in pCons::upp was constructed as follow.
Table 5 : primers sequences
Name Primer sequences
Hyd 1 SEQ ID N°25 AAAAGGATCCGCCTCTTCTGTATTATGCAAGGAAAGCAGCTGC
Hyd 2 SEQ ID N°26 GGGGAGGCCTAAAAAGGGGGTATATAAAATAAATGTGCCTTAACATC
TAAGTTGAGGCC
Hyd 3 SEQ ID N°27 CCCCCTTTTTAGGCCTCCCCGTTTATCCTCCCAAAATGTAAAATATAA
TTAAAATATATTAATAAACTTCGATTAATAAACTTCG
Hyd 4 SEQ ID N°28 AAAAGGATCCCCTTTTAGCGTATAAAGTTTTATATAGCTATTG
Hyd 0 SEQ ID N°29 CATGTTCTATTGTTACTATGGAAGAGGTAGTAG
Hyd 5 SEQ ID N°30 GCAGTTATTATAAATGCTGCTACTAGAGC
Two DNA fragments surrounding hydA (CAC028) were PCR amplified with the Pwo polymerase with total DNA from C. acetobutylicum as template and two specific couples of olignonucleotides. With the couples of primers HYD 1-HYD 2 and HYD 3–HYD 4, 1269 bp and 1317 bp DNA fragments were respectively obtained. Both primers HYD 1 and HYD 4 introduce a BamHI site while primers HYD 2 and HYD 3 have a complementary region which introduces a StuI site. DNA fragments HYD 1-HYD 2 and HYD 3–HYD 4 were joined in a PCR fusion experiment with primers HYD 1 and HYD 4 and the resulting fragment was cloned in pCR4-TOPO-Blunt to yield pTOPO :HYD. At the unique StuI site of pTOPO :HYD, an antibiotic resistance MLS gene with FRT sequences on both sides was introduced from the 1372 bp StuI fragment of pUC18-FRT-MLS2. The UPP deletion cassette obtained after BamHI digestion of the resulting plasmid was cloned into pCons::upp at the BamHI site to yield the pREPHYD::upp plasmid.
The pREPHYD::upp plasmid was used to transform by electroporation C. acetobutylicum MGCcac15uppΔbukΔctfABΔldh strain. After selection on Petri plate for clones resistant to erythromycin (40 µg/ml), one colony was cultured for 24 hours in liquid synthetic medium with erythromycin at 40 µg/ml and 100 l of undiluted culture was plated on RCA with erythromycin at 40 µg/ml and 5-FU at 400 µM. Colonies resistant to both erythromycin and 5-FU were replica plated on both RCA with erythromycin at 40 µg/ml and RCA with thiamphenicol at 50 µg/ml to select clones where 5-FU resistance is also associated with thiamphenicol sensitivity. The genotype of clones resistant to erythromycin and sensitive to thiamphenicol was checked by PCR analysis (with primers HYD 0 and HYD 5 located outside of the hydA deletion cassette). The cac15uppbukΔctfABΔldhΔhydA::mlsR strain which have lost pREPHYD::upp was isolated.
The cac15uppbukΔctfABΔldhΔhydA::mlsR strain was transformed with pCLF1.1 vector expressing the Flp1 gene encoding the Flp recombinase from S. cerevisiae. After transformation and selection for resistance to thiamphenicol (50 µg/ml) on Petri plate, one colony was cultured on synthetic liquid medium with thiamphenicol at 50 µg/ml and appropriate dilutions were plated on RCA with thiamphenicol at 50 µg/ml. Thiamphenicol resistant clones were replica plated on both RCA with erythromycin at 40 µg/ml and RCA with thiamphenicol at 50 µg/ml. The genotype of clones with erythromycin sensitivity and thiamphenicol resistance was checked by PCR analysis with primers HYD 0 and HYD 5. Two successive 24 hours cultures of the cac15uppbukΔctfABΔldhΔhydA strain with erythromycin sensitivity and thiamphenicol resistance were carried out in order to lose pCLF1.1. The cac15uppbukΔctfABΔldhΔhydA strain which has lost pCLF1.1 was isolated according to its sensitivity to both erythromycin and thiamphenicol.
EXAMPLE 6
Batch fermentation of n-butanol producing strains.
Strains were initially analyzed in anaerobic flask cultures in the synthetic medium described by Soni et al (Soni et al, 1987, Appl. Microbiol.Biotechnol. 27:1-5) supplemented with 2.5 g/l of ammonium acetate. An overnight culture at 35°C was used to inoculate a 30 ml culture to an OD600 of 0.05. After incubation of the culture for 3 days at 35°C, glucose, organic acids and solvents were analyzed by HPLC using a Biorad HPX 97H column for the separation and a refractometer for the detection.
Strains with the correct phenotype were subsequently tested under production conditions in 300 ml fermentors (DASGIP) using an anaerobic batch protocol.
For this purpose the fermentor was filled with 250 ml of synthetic medium, sparged with nitrogen for 30 min and inoculated with 25 ml of preculture to an optical density (OD600nm) between 0.05 and 0.1.
The temperature of the culture was maintained constant at 35 °C and the pH was permanently adjusted at 5.5 using an NH4OH solution. The agitation rate was maintained at 300 rpm during the fermentation.
EXAMPLE 7
Continuous fermentation of n-butanol producing strains.
The best n-butanol producing strain was analyzed in chemostat cultures in the synthetic medium described by Soni et al (Soni et al, 1987, Appl. Microbiol.Biotechnol. 27:1-5). An overnight culture at 35°C was used to inoculate a 300 ml fermentors (DASGIP) using an anaerobic chemostat protocol.
For this purpose the fermentor was filled with 250 ml of synthetic medium, sparged with nitrogen for 30 min and inoculated with 25 ml of preculture to an optical density (OD600nm) between 0.05 and 0.1. After 12 hours of batch culture at 35 °C, pH 5.5 (regulated using an NH4OH solution) and an agitation rate of 300 rpm, the fermentor was continuously fed with oxygen free synthetic medium at a dilution rate of 0.05 h-1 while the volume was kept constant by sequential removal of fermentated medium. Stability of the culture was followed by products analysis using the HPLC protocol previously described.
REFERENCES
Desai RP, Harris LM, Welker NE, Papoutsakis ET.
Metabolic flux analysis elucidates the importance of the acid-formation pathways in regulating solvent production by Clostridium acetobutylicum.
Metab Eng. 1999,1:206-13.
Green EM, Bennett GN.
Genetic manipulation of acid and solvent formation in clostridium acetobutylicum ATCC 824
Biotechnol Bioeng. 1998, 58:215-21.
Green EM, Boynton ZL, Harris LM, Rudolph FB, Papoutsakis ET, Bennett GN.
Genetic manipulation of acid formation pathways by gene inactivation in Clostridium acetobutylicum ATCC 824.
Microbiology. 1996,142 :2079-86.
Harris LM, Desai RP, Welker NE, Papoutsakis ET.
Characterization of recombinant strains of the Clostridium acetobutylicum butyrate kinase inactivation mutant: need for new phenomenological models for solventogenesis and butanol inhibition?
Biotechnol Bioeng. 2000,;67:1-11.
Soni B. K., Soucaille P. Goma G.
Continuous acetone butanol fermentation : influence of vitamins on the metabolic activity of Clostridium acetobutylicum.
Appl. Microbiol. Biotechnol. 1987. 27 : 1-5.
CLAIMS
1) A method for the production of n-butanol by culturing a microorganism in an appropriate culture medium comprising a source of carbon and recovery of n-butanol from the culture medium, wherein at least one gene involved in butyrate formation is deleted in the microorganism.
2) A method according to claim 1 wherein the deleted gene is at least one of the following genes:
• ptb encoding phospho-transbutyrylase
• buk encoding butyrate kinase.
3) A method according to claim 1 or 2 wherein at least one gene involved in acetone formation is attenuated in the microorganism.
4) A method according to claim 3 wherein at least one of the following genes is deleted:
• ctfAB encoding CoA-transferase
• adc encoding aceto-acetate decarboxylase.
5) A method according to any one of claims 1 to 4 wherein the microorganism is modified to be unable to produce lactate.
6) A method according to claim 5 wherein the ldh gene is deleted.
7) A method as claimed in any one of claims 1 to 6 wherein the microorganism is modified to be unable to produce acetate.
8) A method as claimed in claim 7 in which at least one gene involved in acetate formation is deleted.
9) A method according to claim 10 wherein the deleted gene is selected among the following :
• pta encoding phospho-transacetylase
• ack encoding acetate kinase.
10) A method as claimed in any one of claims 1 to 9, wherein the hydrogen flux is decreased and the reducing power redirected to butanol production.
11) A method as claimed in claim 10 wherein the hydA gene is attenuated.
12) A method according to anyone of claims 1 to 11 wherein the microorganism is selected among the group consisting of C. acetobutylicum, C. beijerinckii, C. saccharoperbutylacetonicum or C. saccharobutylicum.
13) A method according to anyone of claims 1 to 14 wherein the culture is continuous and stable.
14) A method according to claim 13 comprising the following steps:
a) Fermentation of the microorganism producing n-butanol
b) Elimination of n-butanol during the fermentation by gas striping.
c) Isolation of n-butanol from the condensate by distillation.
15) A microorganism as defined in any one of claims 1 to 12.
ABSTRACT
Process for the biological production of n-Butanol with high yield
The present invention provides a method for the biological production of n-butanol at high yield from a fermentable carbon source. In one aspect of the present invention, a process for the conversion of glucose to n-butanol is achieved by the use of a recombinant organism comprising a host C. acetobutlicum transformed i) to eliminate the butyrate pathway ii) to eliminate the acetone pathway iii) to eliminate the lactate pathway and iv) to eliminate the acetate pathway. In another aspect of the present invention, the hydrogen flux is decreased and the reducing power redirected to n-butanol production by attenuating the expression of the hydrogenase gene. Optionally the n-butanol produced can be eliminated during the fermentation by gas striping and further purified by distillation.
Translation - Spanish Procedimiento para la producción biológica de n-Butanol con alto rendimiento
CAMPO DE LA INVENCIÓN
La invención comprende un procedimiento para la bioconversión de una fuente de carbono fermentable en n-butanol con un alto grado de rendimiento, mediante un microorganismo que ha sido modificado por ingeniería metabólica.
ANTECEDENTES DE LA INVENCIÓN
El n-Butanol es un líquido neutro e incoloro, de mediana volatilidad, y de miscibilidad restringida en agua (alrededor de 7 a 8%), pero libremente miscible con todos los solventes comunes tales como glicoles, cetonas, alcohol, aldehidos, éteres, e hidrocarburos aromáticos y alifáticos. El n-Butanol se utiliza i) para preparar otros productos químicos, ii) como solvente y iii) como un ingrediente en productos formulados, tales como los cosméticos. El uso más importante de n-butanol como materia prima es en la síntesis de ésteres acrilato/metacrilato, glicol éteres, n-Butil acetatos, amino resinas y n-Butilaminas. En la actualidad, a nivel mundial, se consumen más de 9 millones de toneladas anuales de n-Butanol.
Recientemente, se ha demostrado que n-butanol es un mejor biocombustible que el etanol debido a su menor presión de vapor, mayor contenido de energía (cercana a la de la gasolina) y una menor susceptibilidad a separarse en la presencia de agua. El n-butanol incluso puede ser mezclado a mayores concentraciones que el etanol para ser utilizado en motores estándar de vehículos y no requiere que los fabricantes de automóviles se vean obligados a comprometer la performance para cumplir con las reglamentaciones ambientales; también es adecuado para ser transportado a través de cañerías y, en consecuencia, ofrece la posibilidad de ser introducido rápidamente en la gasolina, evitando así la necesidad de infrestructuras de abastecimiento a gran escala.
El n-butanol puede ser obtenido como una mezcla de acetona/n-butanol/etanol (ABE) por la fermentación de carbohidratos mediante Clostridia solventogénica. Las fermentaciones ABE son bifásicas. Durante la primera fase acidogénica, la alta velocidad de crecimiento va acompañada por la producción de ácidos acético y butírico. En la segunda fase solventogénica, la velocidad de crecimiento decrece y los solventes (ABE) son producidos con el concomitante consumo de los ácidos producidos en la primera fase. Durante el transcurso de toda la fermentación, se produce anhídrido carbónico e hidrógeno.
La producción biológica de n-butanol, representada en la figura 1, requiere la formación de butiril-CoA como un intermediario que puede ser reducido, dependiendo de las condiciones fisiológicas, por dos aldehido-alcohol dehidrogenasas bi-funcionales diferentes, codificadas por adhE1 y adhE2. El Butiril-CoA también puede ser convertido a ácido butírico mediante la fosfo-transbutirilasa y la butirato cinasa, codificadas respectivamente por los genes ptb y buk. La acetona es producida por la aceto-acetil-CoA (un intermediario en la producción de butiril-CoA) por medio de una CoA-transferasa y una acetoacetato decarboxilasa codificadas, respectivamente, por los genes ctfAB y adc. El hidrógeno es producido por una hierro único hidrogenasa codificada por el gen hydA. Cuando se hacen cultivos en presencia de monóxido de carbono, que es un inhibidor de la hidrogenasa, los principales productos de la fermentación son n-butanol, etanol y lactato. El lactato es producido a partir de piruvato por la lactato dehidrogenasa codificada por el gen ldh.
En el artículo (Green et al., 1996) ya se han descrito cepas de Clostridium acetobutilicum con un gen inactivado buk (obtenido por una simple cruza con un plásmido no replicable). El vector no replicable pJC4BK, con un fragmento interno buk de 0.8 kb, fue integrado en el gen buk cromosómico, lo que condujo a la inactivación del gen endógeno. La cepa obtenida se denominó “mutante PJC4BK” basado en el nombre del plásmido. Como se ha determinado en este artículo, esta integración genética no eliminó por completo la actividad enzimática, así como tampoco la formación de butirato debido a la inestabilidad de este tipo de inactivación genética que puede revertirse a una cepa salvaje por excisión de plásmido. Esta cepa mutante luego fue utilizada en diversos estudios (Green y Bennett, 1998; Desai y Harris, 1999; Harris et al., 2000).
Tradicionalmente, la fermentación comercial de ABE se realizaba en partidas batch debido a la inestabilidad de los cultivos contínuos de Clostridia. Se han descrito varios procedimientos para la obtención de solventes. Estos procedimientos rinden n-butanol, acetona y etanol en las proporciones de 6:3:1. En la literatura, se mencionan rendimientos de solvente de 29-34% (18-25% para n-butanol solamente) a partir de una fuente de carbono fermentable. En general, el límite superior es una concentración total de solventes de 16-24 g/l y una concentración de n-butanol de 10-14 g/l debido a la toxicidad del n-butanol obtenido. Sin embargo, estos bajos títulos de solventes ya no parecen ser una limitante económica para el procedimiento ya que se ha demostrado recientemente que los solventes pueden ser recuperados durante la fermentación mediante el uso de tecnología de stripping gaseoso de bajo costo.
El problema a ser resuelto por la presente invención es el de obtener una cepa mutante estable sin actividad de la butirato cinasa, que pueda ser cultivada por varias generaciones sin ninguna posibilidad de reversión al tipo salvaje de genotipo. Esta cepa puede ser útil para la producción de n-butanol con rendimientos altos, a partir de un sustrato carbonado tal como glucosa u otro azúcar, por intermedio de cultivos de Clostridia genéticamente estables. Para que la producción de n-butanol resulte industrialmente viable, el número de etapas bioquímicas necesarias para inactivar y la complejidad de la regulación del metabolismo, hace necesario el uso de un catalizador obtenido por ingeniería metabólica.
RESUMEN DE LA INVENCIÓN
Los solicitantes han resuelto el problema citado y la invención presente provee un método para la bioconversión de una fuente carbonada fermentable a n-butanol como producto mayoritario por medio de cultivos genéticamente estables de Clostridia. Se utiliza la glucosa como sustrato modelo y el Clostridium acetobutilicum recombinante es utilizado como huésped modelo. En un aspecto de la invención, se construye un recombinante estable de C. acetobutilicum incapaz de metabolizar el butiril-CoA a butirato borrando el gen que codifica a la butirato cinasa (buk). En otro aspecto de esta invención, se construye un recombinante de C. acetobutilicum que es incapaz de producir acetona borrando los genes que codifican a la CoA-transferasa (ctfAB). En otro aspecto de esta invención, se construye una cepa recombinante incapaz de producir lactato, borrando el gen que codifica a la lactato dehidrogenasa (ldh). Adicionalmente, se construye un recombinante de C. acetobutilicum, incapaz de producir acetato, borrando los genes que codifican a la fosfotransacetilasa y/o la acetato cinasa (pta y ack). En un aspecto final de esta invención, se disminuye el flujo de producción de hidrógeno y entonces el flujo de reductores equivalentes es redireccionado a la producción de n-butanol mediante la atenuación del gen que codifica a la hidrogenasa (hydA).
La presente invención se aplica, en forma general, incluyendo todo sustrato carbonado que sea fácilmente convertido en acetil-coA.
De acuerdo a lo planteado, uno de los objetos de la presente invención es proveer un organismo recombinante útil para la producción de n-butanol que comprenda: (a) por lo menos el borrado de uno de los dos genes involucrados en la conversión del butiril-CoA a butirato y (b) el borrado de por lo menos uno de los genes que codifican la actividad de la CoA-transferasa. Opcionalmente, el organismo recombinante puede involucrar i) inactivar las mutaciones en genes endógenos seleccionados de un grupo que consiste de: (a) un gen que codifica a un polipéptido que tiene actividad lactato dehidrogenasa (b) un gen que codifica a un polipéptido que tiene actividad fosfo-transacetilasa o acetato cinasa y ii) atenuación en un gen que codifica para un polipéptido que tiene actividad hidrogenasa.
En otra disposición, la invención provee un procedimiento estable para la producción de n-butanol con un alto rendimiento a partir de un organismo recombinante que comprende: (a) contactar el organismo recombinante de la presente invención con, por lo menos, una fuente de carbono seleccionada de un grupo consistente en monosacáridos, oligosacáridos, polisacáridos, y sustratos con un solo carbono con los cuales se produce n-butanol; opcionalmente (b) recuperación del n-butanol durante la producción por intermedio de stripping gaseoso y (c) purificación del n-butanol del condensado por destilación.
BREVE DESCRIPC IÓN DE LOS DIBUJOS
El dibujo que se acompaña, que está incorporado y forma parte de estas especificaciones es un ejemplo de la invención la invención y, conjuntamente con la descripción, sirven para explicar los principios de esta invención.
La Figura 1 ilustra la ingeniería genética del metabolismo central en el desarrollo de un sistema de producción de butanol a partir de carbohidratos.
1 : Piruvato-ferredoxin oxidoreductasa ; 2 : Tiolasa ; 3 : -Hidroxibutiril-CoA dehidrogenasa ; 4 : Crotonasa ; 5 : butiril-CoA dehidrogenasa ; 6 : Lactato dehidrogenasa ; 7 : Fosfo-transacetilasa ; 8 : Acetato cinasa ; 9 : Acetaldehido dehidrogenasa ; 10 : Etanol dehidrogenasa ; 11 : CoA transferasa (Acetoacetil-CoA :acetato/butirato : CoA transferasa) ; 12 : Acetoacetato decarboxilasa ; 13 : Fosfo-transbutirilasa ; 14 : Butirato cinasa ; 15 : Butiraldehido-Butanol dehidrogenasa ; 16 : hidrogenasa.
DESCRIPCIÓN DETALLADA DE LA INVENCIÓN
Según son utilizados en el presente escrito, los siguientes términos pueden ser utilizados para la interpretación de las reinvidicaciones y especificaciones.
El término “microorganismo” se refiere a todo tipo de organismos unicelulares, incluyendo organismos procariotas como las bacterias, y organismos eucariotas tales como las levaduras.
La expresión “medio de cultivo apropiado” se refiere a un medio de cultivo adaptado para el microorganismo utilizado y que es bien conocido por el experto en el arte.
El término "sustrato carbonado" o "fuente de carbono" significa toda fuente de carbono capaz de ser metabolizada por un microorganismo en el cual el sustrato contiene por lo menos un átomo de carbono. En particular, puede ser glucosa, sacarosa, mono y oligosacáridos, almidón y sus derivados, glicerina, y las mezclas que se obtengan entre ellas.
El término “atenuación” se refiere a la disminución de la expresión de un gen o una disminución en la actividad de la proteína resultante de ese gen. El experto en el arte conoce numerosos medios para obtener este resultado, y por ejemplo:
- Introducción de una mutación en el gen, disminuyendo el nivel de expresión de ese gen, o el nivel de actividad de la proteína codificada.
- Reemplazo del promotor natural del gen por otro promotor de menor fuerza, lo que resulta en una menor expresión.
- Uso de elementos que desestabilizan el mensajero ARN correspondiente o la proteína.
- Borrado del gen si no se necesita su expresión.
El término “gen borrado” significa que una parte sustancial de la secuencia del código de dichol gen ha sido borrada. Preferentemente, por lo menos el 50% del la secuencia del código ha sido borrada, y más preferentemente por lo menos el 80%.
En la descripción de la presente invención, las enzimas son identificadas por sus actividades específicas. Por lo tanto, esta definición incluye todos los polipéptidos que tienen la actividad específica definida también presente en otros organismos, más particularmente en otros microorganismos. Frecuentemente se pueden identificar enzimas con actividades similares por su agrupamiento en ciertas familias definidas como PFAM o COG.
La PFAM (base de datos de familias de proteínas de alineamientos y modelos escondidos de Markov; http://www.sanger.ac.uk/Software/Pfam/) representa una gran colección de alineamientos de secuencias de proteínas. Cada PFAM hace que sea posible visualizar alineamientos múltiples, ver los dominios de las proteínas, evaluar la distribución entre los organismos, lograr acceso a otras basese de datos, y visualizar estructuras conocidas de las proteínas.
Los COGs (clusters de grupos ortólogos de proteínas; http://www.ncbi.nlm.nih.gov/COG/) se obtienen comparando las secuencias de proteínas de 43 genomas completamente secuenciados que representan a 30 de las principales líneas filogénicas. Cada COG se define a partir de por lo menos tres líneas, lo que permite la identificación de los dominios anteriores conservados.
Los medios para identificar secuencias homólogas y el porcentaje de homologación, son bien conocidos por los expertos en el arte, e incluyen, en particular, los programas BLAST, que pueden ser obtenidos del sitio web http://www.ncbi.nlm.nih.gov/BLAST/ utilizando los parámetros por defecto que se indican en dicho sitio Web. Las secuencias obtenidas pueden entonces ser explotadas (esto es., alineadas) utilizando, por ejemplo, los programas CLUSTALW http://www.ebi.ac.uk/clustalw/) o MULTALIN http://prodes.toulouse.inra.fr/multalin/cgi-bin/multalin.pl), con los parámetros por defecto indicados en esos sitios web.
Utilizando las referencias dadas en GenBank para genes conocidos, los expertos en el arte son capaces de determinar los genes equivalentes en otros organismos, cepas bacterianas, levaduras, hongos, mamíferos, plantas. etc. Este trabajo de rutina se realiza ventajosamente utilizando secuencias de consenso que pueden ser determinadas llevando a cabo alineamientos de secuencias con genes derivados de otros microorganismos, y diseñando sondas degeneradas para clonar el correspondiente gen en otro organismo. Estos métodos de rutina en biología molecular son bien conocidos por los expertos en el arte y han sido descritos, por ejemplo, en Sambrook et al. (Molecular Cloning: a Laboratory Manual. 2nd ed. Cold Spring Harbor Lab., Cold Spring Harbor, New York, 1989.).
La invención presente ofrece un método para la producción por fermentación de n-butanol, tanto en batch como en forma contínua, a través del cultivo de un microorganismo en un medio de cultivo adecuado y que incluye una fuente de carbono y la recuperación simultánea de n-butanol del medio de cultivo, donde se elimina del microorganismo por lo menos un gen involucrado en la formación de butirato.
Una forma específica de la invención, provee un método en el cual el microorganismo es modificado para que sea incapaz de convertir butiril-CoA a butirato como resultado del borrado de por lo menos uno de los genes que codifican a la fosfo-transbutirilasa (ptb) o butirato cinasa (buk). El borrado de genes en Clostridia puede ser realizado utilizando el método recientemente descrito en la solicitud de patente PCT/EP2006/066997 que permite el i) reemplazo del gen a ser borrado por un gen de resistencia a la eritromicina y ii) eliminación del gen de resistencia a la eritromicina mediante una recombinasa.
En otro aspecto de la invención, el microorganismo es incapaz de producir acetona debido a la atenuación o borrado de por lo menos uno de los genes involucrados en la formación de acetona. Preferentemente, este gen codifica a la enzima CoA-transferasa (ctfAB) o acetoacetato decarboiylasa (adc). El borrado de uno de estos genes puede ser realizado utilizando el método descrito recientemente en la solicitud de patente PCT/EP2006/066997.
En un aspecto subsiguiente de la invención, el microorganismo utilizado en el método de la invención es incapaz de producer lactato. En particular, esto puede deberse al borrado del gen ldh que codifica a lactato dehidrogenasa. El borrado del ldh puede llevarse a cabo utilizando la técnica descrita en la solicitud de patente PCT/EP2006/066997.
En otra forma de la invención, el microorganismo se modifica de tal manera que es incapaz de producir acetato. Este resultado puede ser obtenido borrando por lo menos uno de los genes involucrados en la formación de acetato. Preferentemente este gen se selecciona de entre el grupo consistente en los genes que codifican a la fosfo-transacetilasa (pta) o acetato cinasa (ack). El borrado de uno de estos genes puede ser hecho utilizando el método recientemente descrito en la solicitud de patente PCT/EP2006/066997.
Una forma de la invención provee a los microorganismos con una disminución del flujo de producción de hidrógeno y luego con un redirecionamiento del flujo de equivalente reductor hacia la producción de n-butanol; esto se puede lograr atenuando el gen que codifica la hidrogenasa (hydA), una enzima que prove de un sumidero para equivalentes reductores bajo la forma de producción de hidrógeno. La atenuación de hydA puede ser realizada reemplazando al promotor natural por un promotor de baja fuerza o por desestabilización elemental del mensajero ARN o la proteína correspondientes. Sin es necesario, la atenuación completa del gen se puede lograr borrando la secuencia correspondiente del ADN.
Preferentemente, el microorganismo utilizado se selecciona de entre un grupo consistente en C. acetobutilicum, C. beijerinckii, C. saccharoperbutilacetonicum o C. saccharobutilicum.
En otra forma de la invención, el cultivo es contínuo y estable.
En otra forma de la invención, el método de acuerdo a la invención comprende las siguientes etapas:
(a) Poner en contacto un microorganismo con, por lo menos, una fuente de carbono seleccionado de un grupo consistente de glucosa, xilosa, arabinosa, sacarosa, monosacáridos, oligosacáridos, polisacáridos, celulosa, xilanos, almidón y sus derivados y glicerina, mediante los cuales se produce n-butanol.
(b) Recuperación del n-butanol durante la fermentación por stripping gaseoso y
(c) Aislación del n-butanol del condensado por destilación.
Los expertos en el arte son capaces de definir las condiciones de fermentación para los microorganismos de acuerdo a la invención. En particular las Clostridia son fermentadas a una temperatura entre 20°C y 55°C, preferentemente entre 25°C y 40°C, y más específicamente alrededor de 35°C para C. acetobutilicum.
La fermentación generalmente se realiza en fermentadores con un medio inorgánico de composición conocida y definida, adaptado a la bacteria utilizada, que contiene por lo menos una fuente sencilla de carbono y, si es necesario, un cosustrato necesario para la producción del metabolito.
La invención también está relacionada con el microorganismo tal como se describió anteriormente. Preferentemente, este microorganismo es seleccionado de entre el grupo consistente en C. acetobutilicum, C. beijerinckii, C. saccharoperbutilacetonicum o C. saccharobutilicum.
EJEMPLO 1
Construcción de cepas incapaces de producir butirato: Clostridium acetobutilicum Δcac1515 Δupp Δbuk
Para borrar el gen buk, se utiliza la estrategia de recombinación homóloga de Croux & Soucaille (2006) descrita en la solicitud de patente PCT/EP2006/066997. Esta estrategia permite la inserción de un cassette de resistencia a la eritromicina, mientras se borra buena parte del gen en cuestión. El cassette de borrado buk en pCons::upp se construyó como sigue.
Tabla 1 : secuencias de los cebadores
Nombre Secuencias de los cebadores
Buk 1 SEC ID N°1 aaaaggatcctagtaaaagggagtgtacgaccagtg
Buk 2 SEC ID N°2 ggggtcgcgaaaaaaggggggattattagtaatctatacatgttaacattcctccac
Buk 3 SEC ID N°3 cccccttttttcgcgaccccacttcttgcacttgcagaaggtggac
Buk 4 SEC ID N°4 aaaaggatcctctaaattctgcaatatatgccccccc
Buk 0 SEC ID N°5 ataacaggatatatgctctctgacgcgg
Buk 5 SEC ID N°6 gatcatcactcattttaaacatggggcc
Dos fragmentos de ADN rodeando a buk, fueron amplificados por PCR con la Pwo polimerasa utilizando el ADN total de C. acetobutilicum como plantilla y dos pares específicos de oligonucleótidos. Con los dos pares de cebadores BUK 1-BUK 2 y BUK 3–BUK 4, se obtuvieron respectivamente dos fragmentos de ADN. Ambos cebadores BUK 1 y BUK 4 introducen un sitio BamHI mientras que los cebadores BUK 2 y BUK 3 tienen una región complementaria que introduce un sitio NruI. Los fragmentos de ADN BUK 1-BUK 2 y BUK 3–BUK 4 fueron unidos en un experimento de fusión PCR con los cebadores BUK 1 y BUK 4 y el fragmento resultante fue clonado en pCR4-TOPO-Romo para obtener pTOPO :buk. En el sitio único de StuI de pTOPO :buk, se introdujo un gen de resistencia a antibióticos MLS con secuencias FRT a ambos lados a partir de un fragmento StuI del pUC18-FRT-MLS2. El cassette de borrado BUK obtenido luego de la digestión BamHI del plásmido resultante fue clonado dentro de pCons::upp en el lugar BamHI para obtener el plásmido pREPBUK::upp.
El plásmido pREPBUK::upp fue utilizado para transformar mediante electroporación la cepa C. acetobutilicum MGCcac15upp. Luego de selección en placa de Petri para clones resistentes a la eritromicina (40 µg/ml), se cultivó una colonia por 24 horas en medio sintético líquido a 40 µg/ml y se sembró 100 l de cultivo sin diluír con eritromicina sobre RCA con eritromicina a 40 µg/ml y 5-FU a 400 µM. Las colonias resistentes tanto a la eritromicina como al 5-FU fueron replicados en ambos RCA con eritromicina a 40 µg/ml y RCA con tiamfenicol a 50 µg/ml para seleccionar clones donde la resistencia al 5-FU también estuviera asociada con la sensibilidad al tiamfenicol. El genotipo de los clones resistentes a la eritromicina y sensibles al tiamfenicol fue comprobada por análisis PCR (con cebadores BUK 0 y BUK 5 localizados fuera del cassette de borrado buk). Se aisló la cepa cac15uppbuk::mlsR que perdió el pREPbuk::upp.
La cepa cac15uppbuk::mlsR fue transformada con el vector pCLF1.1 que expresa al gen Flp1 que codifica la Flp recombinasa de S. cerevisiae. Luego de efectuada la transformación y selección para la resistencia a tiamfenicol (50 µg/ml) sobre placa Petri, se cultivó una colonia en un medio sintético líquido con tiamfenicol a 50 µg/ml y se sembraron diluciones apropiadas en RCA con tiamfenicol a 50 µg/ml. Los clones resistentes al tiamfenicol fueron replicados en RCA con eritromicina a 40 µg/ml y RCA con tiamfenicol a 50 µg/ml. Se comprobó el genotipo de los clones con sensibilidad a la eritromicina y resistencia al tiamfenicol por análisis PCR con los cebadores BUK 0 y BUK 5. Se llevaron a cabo dos cultivos sucesivos de 24 horas de la cepa cac15uppbuk, con sensibilidad a la eritromicina y resistencia al tiamfenicol, con la finalidad de perder pCLF1.1. La cepa cac15uppbuk que perdió pCLF1.1 fue aislada de acuerdo a su sensibilidad tanto a la eritromicina como al tiamfenicol.
EJEMPLO 2
Construcción de cepas incapaces de producir butirato y acetona: C. acetobutilicum Δcac1515 Δupp Δbuk ΔctfAB
Para borrar los genes ctfAB, se utiliza la estrategia homóloga recombinante de Croux & Soucaille (2006) descrita en la solicitud de patente PCT/EP2006/066997. Esta estrategia permite la inserción de un cassette de resistencia a la eritromicina, mientras se borra la mayoría de los genes en cuestión. El cassette de borrado ctfAB en pCons::upp se construyó de la siguiente manera:
Tabla 2 : secuencias de los cebadores.
Nombre Secuencias de los cebadores
Ctf 1 SEC ID N°7 aaaaggatcccagacactataatagctttaggtggtacccc
Ctf 2 SEC ID N°8 ggggaggcctaaaaagggggattataaaaagtagttgaaatatgaaggtttaaggttg
Ctf 3 SEC ID N°9 ccccctttttaggcctccccatatccaatgaacttagacccatggctg
Ctf 4 SEC ID N°10 aaaaggatccgtgttataatgtaaatataaataaataggactagaggcg
Ctf 0 SEC ID N°11 taccaccttctttcacgcttggctgcgg
Ctf 5 SEC ID N°12 tatttaaagaggcattatcaccagagcg
Dos fragmentos de ADN alrededor de ctfAB fueron amplificados por PCR con la Pwo polimerasa utilizando el ADN total de C. acetobutilicum como plantilla y dos pares específicos de oligonucleótidos. Con los pares de cebadosres CTF 1-CTF 2 y CTF 3–CTF 4, se obtuvieron, respectivamente, dos fragmentos de ADN. Ambos cebadores CTF 1 y CTF 4 introducen un sitio BamHI mientras que los cebadores CTF 2 y CTF 3 tienen una región complementaria que introduce el sitio StuI. Los fragmentos de ADN CTF 1-CTF 2 y CTF 3–CTF 4 fueron unidos mediante un experimento de fusión PCR con los cebadores CTF 1 y CTF 4 y el fragmento resultante fue clonado en pCR4-TOPO-Romo para obtener pTOPO :CTF. En el sitio único de pTOPO :CTF, se introdujo un gen MLS de resistencia a los antibióticos con secuencias FRT a ambos lados a partir de un fragmento del StuI de pUC18-FRT-MLS2. El cassette de borrado UPP obtenido luego de la digestión BamHI del plásmido resultante fue clonado en pCons::upp en el sitio BamHI para obtener el plásmido pREPCTF::upp.
El plásmido pREPCTF::upp fue utilizado para transformar mediante electroporación a la cepa C. acetobutilicum MGCcac15uppΔbuk. Luego de seleccionar sobre placas Petri los clones resistentes a la eritromicina (40 µg/ml), se cultivó una colonia por 24 horas en un medio sintético líquido con aritromicina a 40 µg/ml, y 100 l del cultivo sin diluír fue sembrado sobre RCA con eritromicina a 40 µg/ml y 5-FU at 400 µM. Las colonias resistentes tanto a la eritromicina como al 5-FU fueron replicadas en ambos RCA con eritromicina a 40 µg/ml y RCA con tiamfenicol a 50 µg/ml para seleccionar clones donde la resistencia al5-FU también estuviera asociada con sensibilidad al tiamfenicol. El genotipo de los clones resistentes a la eritromicina y sensibles al tiamfenicol fue verificado por análisis por PCR (con los cebadors CTF 0 y CTF 5 localizados fuera del cassette de borrado ctfAB). Se aisló la cepa cac15uppbuk ΔctfAB::mlsR que había perdido pREPCTF::upp.
La cepa cac15uppbukΔctfAB::mlsR fue transformada con el vector pCLF1.1 que expresa el gen Flp1 que codifica a la Flp recombinasa de S. cerevisiae. Luego de la transformación y selección para la resistencia al tiamfenicol (50 µg/ml) sobre placa Petri, se cultivó una colonia en medio sintético líquido con tiamfenicol a 50 µg/ml y se sembraron diluciones apropiadas sobre RCA con tiamfenicol a 50 µg/ml. Los clones resistentes al tiamfenicol fueron replicados sobre RCA con eritromicina a 40 µg/ml y RCA con tiamfenicol a 50 µg/ml. El genotipo de los clones con sensibilidad a la eritromicina y resistencia al tiamfenicol fue comprobado por análisis PCR con cebadores CTF 0 y CTF 5. Se llevaron a cabo dos cultivos sucesivos de 24 horas de la cepa cac15uppbukΔctfAB con sensibilidad a la eritromicina y resistencia al tiamfenicol con la finalidad de perder pCLF1.1. La cepa cac15uppbukΔctfAB que había perdido pCLF1.1 fue aislada de acuerdo a su sensibilidad tanto a la eritromicina como al tiamfenicol.
EJEMPLO 3
Construcción de cepas incapaces de producir butirato, acetona y lactato: C. acetobutilicum Δcac1515 Δupp Δbuk ΔctfAB Δldh
Para borrar el gen ldh, se usa la estrtegia recombinante homóloga descrita por Croux & Soucaille (2006) en la solicitud de patente PCT/EP2006/066997. Esta etrategia permite la inserción de un cassette de resistencia a la eritromicina mientras se borra la mayoría de los genes en cuestión. El cassette de borrado ldh en pCons::upp se construyó como sigue.
Tabla 3 : secuencias de los cebadores
Nombre Secuencias de los cebadores
Ldh 1 SEC ID N°13 AAAAGGATCCGCTTTAAAATTTGGAAAGAGGAAGTTGTG
Ldh 2 SEC ID N°14 GGGGAGGCCTAAAAAGGGGGTTAGAAATCTTTAAAAATTTCTCTATAGAGCCCATC
Ldh 3 SEC ID N°15 CCCCCTTTTTAGGCCTCCCCGGTAAAAGACCTAAACTCCAAGGGTGGAGGCTAGGTC
Ldh 4 SEC ID N°16 AAAAGGATCCCCCATTGTGGAGAATATTCCAAAGAAGAAAATAATTGC
Ldh 0 SEC ID N°17 CAGAAGGCAAGAATGTATTAAGCGGAAATGC
Ldh 5 SEC ID N°18 CTTCCCATTATAGCTCTTATTCACATTAAGC
Los dos fragmentos de ADN que rodean a ldh (CAC267) fueron amplificados por PCR con la Pwo polimerasa utilizando el ADN total de C. acetobutilicum como plantilla y dos pares específicos de oligonucleótidos. Con las parejas de cebadores LDH 1-LDH 2 y LDH 3–LDH 4, se obtuvieron fragmentos de ADN de 1135 bp y 1177 bp, respectivamente. Ambos cebadores LDH 1 y LDH 4 introducen un sitio BamHI, mientras que los cebadores LDH 2 y LDH 3 tienen una región complementaria que introduce un sitio StuI. Los fragmentos de ADN LDH 1-LDH 2 y LDH 3–LDH 4 fueron unidos en un experimento de fusión en PCR con los cebadores LDH 1 y LDH 4 y el fragmento resultante fue clonado en pCR4-TOPO-Romo para obtener pTOPO :LDH. En el sitio único StuI del pTOPO :LDH, se introdujo un gen MLS de resistencia a antibióticos con secuencias FRT a ambos lados a partir del fragmento 1372 bp StuI del pUC18-FRT-MLS2. El cassette de borrado UPP obtenido luego de la digestión BamHI del plásmido resultante, fue clonado en pCons::upp en el sitio BamHI para obtener el plásmido pREPLDH::upp.
El plásmido pREPLDH::upp fue usado para transformar por electroporación la cepa C. acetobutilicum MGCcac15uppΔbukΔctfAB. Luego de la selección sobre placa Petri para los clones resistentes a la eritromicina (40 µg/ml), una colonia fue cultivada por 24 horas en un medio sintético líquido con eritromicina a 40 µg/ml, y 100 l del cultivo sin diluír fue sembrado sobre RCA con eritromicina a 40 µg/ml y 5-FU a 400 µM. Las colonias resistentes tanto a la eritomicina como al 5-FU fueron replicados sobre RCA con eritromicina a 40 µg/ml y RCA con tiamfenicol a 50 µg/ml para seleccionar los clones donde la resistencia al 5-FU estuviera también asociada con sensibilidad al tiamfenicol. El genotipo de los clones resistentes a la eritromicina y sensibles al tiamfenicol fue verificado por análisis PCR (con los cebadores LDH 0 y LDH 5 localizados fuera del cassette de borradoted ldh). Se aisló la cepa cac15uppbuk ΔctfAB Δldh::mlsR que había perdido pREPLDH::upp.
La cepa cac15uppbukΔctfABΔldh::mlsR fue transformada con el vector pCLF1.1 que expresa el gen Flp1 que codifica a la Flp recombinasa de la S. cerevisiae. Luego de la transformación y selección para resistencia al tiamfenicol (50 µg/ml) sobre placa Petri, se cultivó una colonia en un medio sintético líquido con tiamfenicol a 50 µg/ml y se sembraron diluciones apropiadas en RCA con tiamfenicol a 50 µg/ml. Los clones resistentes fueron replicados en RCA con eritromicina a 40 µg/ml y RCA con tiamfenicol a 50 µg/ml. El genotipo de los clones con sensibilidad a la eritromicina y resistencia al tiamfenicol fue verificado por análisis por PCR con los cebadores LDH 0 y LDH 5. Se realizaron dos cultivos sucesivos de 24 horas de la cepa cac15uppbukΔctfAB Δldh con sensibilidad a la eritromicina y resistencia al tiamfenicol con la finalidad de perder pCLF1.1. La cepa cac15uppbukΔctfABΔldh que había perdido pCLF1.1 fue aislada de acuerdo a su sensibilidad tanto a la eritromicina como al tiamfenicol.
EJEMPLO 4
Construcción de cepas incapaces de producir butirato, acetona, lactato y acetato: C. acetobutilicum Δcac1515 Δupp Δbuk ΔctfAB Δldh Δpta-ack
Para borrar los genes pta y ack, se usa la estrategia recombinante homóloga descrita por Croux & Soucaille (2006) en la solicitud de patente PCT/EP2006/066997. Esta estrategia permite la introducción de un cassette de resistencia a la eritromicina, mientras se borra la mayoría de los genes involucrados. El cassette de borrado pta-ack en pCons::upp se construyó como sigue.
Tabla 4 : Secuencias de los cebadores
Nombre Secuencias del cebador
PA 1 SEC ID N°19 aaaaggatcctattataacagtcaaacccaataaaatactggg
PA 2 SEC ID N°20 ggggaggcctaaaaagggggttaatccatttgtattttctcccttcataatgcc
PA 3 SEC ID N°21 ccccctttttaggcctcccctttattttgcatgcttatataataaattatggctgcg
PA 4 SEC ID N°22 aaaaggatccgcttttccttcttttacaagatttaaagcc
PA 0 SEC ID N°23 cacttttatttatcaagctgtaggcc
PA 5 SEC ID N°24 tataccttttgaacctaggaaaggc
Dos fragmentos de ADN que rodean pta-ack fueron amplificados por PCR con la Pwo polimerasa utilizando el ADN total de C. acetobutilicum como plantilla y dos pares de oligonucleótidos específicos Con el par de cebadores PA 1-PA 2 y PA 3–PA 4, se obtuvieron respectivamente dos fragmentos de ADN. Ambos cebadores PA 1 y PA 4 introducen un sitio BamHI, mientras que los cebadores PA 2 y PA 3 tienen una región complementaria que introduce un sitio StuI. Los fragmentos de ADN PA 1-PA 2 y PA 3–PA 4 fueron unidos por un experimento de fusión PCR con los cebadores PA 1 y PA 4 y el fragmento resultante fue clonado en pCR4-TOPO-Romo para producir pTOPO :PA. En el sitio único StuI de pTOPO:PA, un gen de resistencia a antibiótico MLS con secuencia FRT a ambos lados fue introducido del fragmento StuI del pUC18-FRT-MLS2. El cassette de borrado UPP obtenido luego de la digestión BamHI del plásmido resultante, se clonó en pCons::upp en el sitio BamHI para obtener el plásmido pREPPA::upp.
El plásmido pREPPA::upp se usó para transformar por electroporación a la cepa C. acetobutilicum MGCcac15uppΔbukΔctfABΔldh. Luego de la selección en placa Petri de los clones resistentes a la eritromicina (40 µg/ml), se cultivó una colonia por 24 horas en un medio sintético líquido con eritromicina a 40 µg/ml, y se sembró 100 l del cultivo sin diluírr sobre RCA con eritromicina a 40 µg/ml y 5-FU a 400 µM. Las colonias resistentes tanto a la eritromicina como al 5-FU fueron replicadas en RCA con eritromicina a 40 µg/ml y RCA con tiamfenicol a 50 µg/ml para seleccionar los clones en los que la resistencia al 5-FU está asociada también a la sensibilidad al tiamfenicol. Se verificó el genotipo de los clones resistentes a la eritromicina y sensibles al tiamfenicol por análisis PCR (con cebadores PA 0 y PA 5 localizados fuera del cassette de borrado pta-ack). Se aisló la cepa cac15uppbuk ΔctfABΔldhΔpta-ack::mlsR que había perdido pREPPA::upp.
La cepa cac15uppbukΔctfABΔldh Δpta-ack::mlsR fue transformada con el vector pCLF1.1 expresando el gen Flp1 que codifica al Flp recombinasa del S. cerevisiae. Luego de la transformación y selección para la resistencia al tiamfenicol (50 µg/ml) sobre placa Petri, una colonia fue cultivada en medio sintético líquido con tiamfenicol a 50 µg/ml y diluciones apropiadas fueron sembradas sobre RCA con tiamfenicol a 50 µg/ml. Los clones resistentes al tiamfenicol fueron replicados sobre RCA con eritromicina a 40 µg/ml y RCA con tiamfenicol a 50 µg/ml. El genotipo de los clones con sensibilidad a la eritromicina y resistencia al tiamfenicol fue verificado por análisis PCR con los cebadores PA 0 y PA 5. Se llevaron a cabo dos cultivos sucesivos de 24 horas de la cepa cac15uppbukΔctfABΔldhΔpta-ack para perder pCLF1.1. La cepa de cac15uppbukΔctfABΔldhΔpta-ack que había perdido pCLF1.1 fue aislada de acuerdo a su sensibilidad tanto a la eritromicina como al tiamfenicol.
EJEMPLO 5
Construcción de cepas con menor producción de hidrógeno: C. acetobutilicum Δcac1515 Δupp Δbuk ΔctfAB Δldh ΔhydA
Para borrar el gen hydA, se usa la estrategia de recombinación de homólogos descrita por Croux & Soucaille (2006) en la solicitud de patente PCT/EP2006/066997. Esta estrategia permite la inserción de un cassette de resistencia a la eritromicina, mientras se borra la mayoría de los genes en cuestión. El cassette de borrado hydA en pCons::upp se construyó como sigue.
Tabla 5 : secuencias de los cebadores
Nombre Secuencia del cebador
Hyd 1 SEC ID N°25 AAAAGGATCCGCCTCTTCTGTATTATGCAAGGAAAGCAGCTGC
Hyd 2 SEC ID N°26 GGGGAGGCCTAAAAAGGGGGTATATAAAATAAATGTGCCTTAACATC
TAAGTTGAGGCC
Hyd 3 SEC ID N°27 CCCCCTTTTTAGGCCTCCCCGTTTATCCTCCCAAAATGTAAAATATAA
TTAAAATATATTAATAAACTTCGATTAATAAACTTCG
Hyd 4 SEC ID N°28 AAAAGGATCCCCTTTTAGCGTATAAAGTTTTATATAGCTATTG
Hyd 0 SEC ID N°29 CATGTTCTATTGTTACTATGGAAGAGGTAGTAG
Hyd 5 SEC ID N°30 GCAGTTATTATAAATGCTGCTACTAGAGC
Dos fragmentos de ADN rodeando hydA (CAC028) fueron amplificados por PCR con la Pwo polimerasa utilizando el ADN total de C. acetobutilicum como plantilla y dos pares específicos de oligonucleótidos. Con los dos pares de cebadores HYD 1-HYD 2 y HYD 3–HYD 4, se obtuvieron los fragmentos de ADN 1269 bp y 1317 bp, respectivamente. Ambos cebadores HYD 1 y HYD 4 introducen un sitio BamHI mientras que los cebadores HYD 2 y HYD 3 tienen una región complementaria que introduce un sitio StuI. Los fragmentos de ADN HYD 1-HYD 2 y HYD 3–HYD 4 fueron unidos mediante un experimento de fusión por PCR con los cebadores HYD 1 y HYD 4 y el fragmento resultante fue clonado en pCR4-TOPO-Romo para producir pTOPO:HYD. Se introdujo en el sitio único StuI del pTOPO :HYD, un gen de resistencia a los antibióticos con secuencias FRT a ambos lados, proveniente del fragmento 1372 bp StuI de pUC18-FRT-MLS2. El cassette de borrado UPP obtenido luego de una digestión BamHI del plásmido resultante fue clonado en pCons::upp en el sitio BamHI para obtener el plásmido pREPHYD::upp.
El plásmido pREPHYD::upp fue usado para transformar por electroporación la cepa C. acetobutilicum MGCcac15uppΔbukΔctfABΔldh. Luego de la selección sobre placa Petri de los clones resistentes a la (40 µg/ml), se cultivó una colonia por 24 horas en un medio sintético líquido con eritromicina a 40 µg/ml y se sembró 100 l del cultivo sin diluir sobre RCA con eritromicina a 40 µg/ml y 5-FU a 400 µM. Las colonias resistentes tanto a la eritromicina como al 5-FU, fueron replicadas sobre RCA con eritromicina a 40 µg/ml y RCA con tiamfenicol a 50 µg/ml para seleccionar clones en los que la resistencia al 5-FU también estuviera asociada con la sensibilidad al tiamfenicol. El genotipo de los clones resistentes a la eritromicina y sensibles al tiamfenicol fue verificado por análisis PCR (con cebadores HYD 0 y HYD 5 localizados fuera del cassette de borrado hydA). Fueron aisladas las cepas cac15uppbukΔctfABΔldhΔhydA::mlsR que habían perdido pREPHYD::upp.
La cepa cac15uppbukΔctfABΔldhΔhydA::mlsR fue transformada con el vector pCLF1.1 que expresa el gen Flp1 que codifica la Flp recombinasa de S. cerevisiae. Luego de la transformación y selección para resistencia al tiamfenicol (50 µg/ml) sobre placa Petri, se cultivó una colonia sobre medio sintético líquido con tiamfenicol a 50 µg/ml y se sembraron diluciones apropiadas sobre RCA con tiamfenicol a 50 µg/ml. Los clones resistentes al tiamfenicol fueron replicados sobre RCA con eritromicina 40 µg/ml y RCA con tiamfenicol 50 µg/ml. Se verificó el genotipo de los clones con sensibilidad a la eritromicina y resistencia al tiamfenicol por análisis por PCR con los cebadores HYD 0 y HYD 5. Se llevaron a cabo dos cultivos sucesivos de 24 horas de la cepa cac15uppbukΔctfABΔldhΔhydA con sensibilidad a la eritromicina y resistencia al tiamfenicol para perder pCLF1.1. La cepa cac15uppbukΔctfABΔldhΔhydA que había perdido pCLF1.1 fue aislada de acuerdo a su sensibilidad tanto a la eritromicina como al tiamfenicol.
EJEMPLO 6
Fermentación Batch de las cepas productoras de n-butanol.
Las cepas fueron analizadas inicialmente en frascos de cultivo con el medio sintético descrito por Soni et al. (Soni et al, 1987, Appl. Microbiol.Biotechnol. 27:1-5) suplementado con 2.5 g/l de acetato de amonio. Se utilizó un cultivo durante la noche a 35°C para inocular un cultivo de 30 ml a una DO600 de 0.05. Luego de la incubación del cultivo por 3 días a 35°C, el contenido de glucosa, ácidos orgánicos y solventes, fue analizado por HPLC usando una columna Biorad HPX 97H para la separación y un refractómetro para la detección.
Las cepas con el fenotipo correcto fueron subsiguientemente ensayadas bajo condiciones de producción en fermentadores de 300 ml (DASGIP) utilizando un protocolo batch anaerobio.
A tal efecto, el fermentador se llenó con 250 ml de medio sintético, espargado con nitrógeno por 30 min e inoculado con 25 ml de un precultivo a una densidad óptica (DO600nm) entre 0.05 y 0.1.
La temperatura del cultivo se mantuvo constante a 35 °C y el pH se ajustó permanentemente a 5.5, utilizando una solución de NH4OH. La velocidad de agitación se mantuvo a 300 rpm durante la fermentación.
EJEMPLO 7
Fermentación contínua de cepas productoras de n-butanol.
Se analizó la principal cepa productora de n-butanol en cultivos chemostat en el medio sintético descrito por Soni et al (Soni et al, 1987, Appl. Microbiol.Biotechnol. 27:1-5). Se utilizó un cultivo durante la noche a 35°C para inocular un fermentador de 300 ml (DASGIP) usando un protocolo anaeróbico Chemostat.
Con esta finalidad, se llenó el fermentador con 250 ml de medio sintético, espargado con nitrógeno por 30 min e inoculado con 25 ml de precultivo a una densidad óptica (DO600nm) entre 0.05 y 0.1. Luego de 12 horas de cultivo batch a 35 °C, pH 5.5 (regulado utilizando una solución de NH4OH) y una velocidad de agitación de 300 rpm, se alimentó el fermentador con un medio sintético libre de oxígeno a una velocidad de dilución de 0.05 h-1 mientras se mantenía el volumen constante extrayendo secuencialmente el medio fermentado. La estabilidad del cultivo se siguió mediante el análisis de los productos, utilizando el protocolo HPLC descrito anteriormente.
REFERENCIAS
Desai RP, Harris LM, Welker NE, Papoutsakis ET.
Metabolic flux analysis elucidates the importance of the acid-formation pathways in regulating solvent production by Clostridium acetobutilicum.
Metab Eng. 1999,1:206-13.
Green EM, Bennett GN.
Genetic manipulation of acid and solvent formation in clostridium acetobutilicum ATCC 824
Biotechnol Bioeng. 1998, 58:215-21.
Green EM, Boynton ZL, Harris LM, Rudolph FB, Papoutsakis ET, Bennett GN.
Genetic manipulation of acid formation pathways by gen inactivation in Clostridium acetobutilicum ATCC 824.
Microbiology. 1996,142 :2079-86.
Harris LM, Desai RP, Welker NE, Papoutsakis ET.
Characterization of recombinant strains of the Clostridium acetobutilicum butirato kinase inactivation mutant: need for new phenomenological models for solventogensis y butanol inhibition?
Biotechnol Bioeng. 2000,;67:1-11.
Soni B. K., Soucaille P. Goma G.
Continuous acetone butanol fermentation: influence of vitamins on the metabolic activity of Clostridium acetobutilicum.
Appl. Microbiol. Biotechnol. 1987. 27 : 1-5.
REINVINDICACIONES
1) Un método para la producción de n-butanol cultivando un microorganismo en un medio de cultivo apropiado que comprende una fuente de carbono y recuperación de n-butanol del medio de cultivo, en el cual por lo menos un gen involucrado en la formación de butirato se ha borrado del microorganismo.
2) Un método de acuerdo a la reinvindicación 1 por el cual el gen borrado es por lo menos uno de los genes siguientes:
• ptb que codifica la fosfo-transbutirilasa
• buk que codifica la butirato cinasa.
3) Un método de acuerdo de las reinvindicaciones 1 y 2 por el cual por lo menos un gen involucrado en la formación de la acetona es atenuado en el microorganismo.
4) Un método de acuerdo a la reinvindicación 3 por el cual por lo menos uno de los siguientes genes es borrado:
• ctfAB que codifica la CoA-transferasa
• adc que codifica la aceto-acetato decarboxilasa.
5) Un método de acuerdo a la reinvindicaciónes 1 a 4 por el cual el microorganismo es modificado para que sea incapaz de producir lactato.
6) Un método de acuerdo a la reinvindicación 5 en el cual se borra el gen ldh.
7) Un método de acuerdo a la reinvindicaciónes 1 a 6 por el cual el microorganismo es modificado para que sea incapaz de producir acetato.
8) Un método de acuerdo a la reinvindicación 7 por el cual se borra por lo menos un gen involucrado en la formación de acetato.
9) Un método de acuerdo a la reinvindicación 10 por el cual el gen borrado es seleccionado entre los siguientes :
• pta que codifica la fosfo-transacetilasa
• ack que codifica la acetato cinasa.
10) Un método de acuerdo a la reinvindicaciones 1 a 9, por los cuales el flujo de de hidrógeno se decrementa y el poder reductor es redireccionado a la producción de butanol.
11) Un método como se ha reinvindicado en la reinvindicación 10 por el cual el gen hydA es atenuado.
12) Un método de acuerdo a cualquiera de las reinvindicaciones 1 a 11 por el cuales el microorganismo es seleccionado de entre un grupo consistente en C. acetobutilicum, C. beijerinckii, C. saccharoperbutilacetonicum o C. saccharobutilicum.
13) Un método de acuerdo a cualquiera de las reinvindicaciones 1 a 14 por el cual el cultivo es contínuo y estable.
14) Un método de acuerdo a la reinvindicación 13 que comprende las siguientes etapas:
a) Fermentación del microorganismo que produce n-butanol
b) Eliminación del n-butanol durante la fermentación por stripping gaseoso.
c) Aislación del n-butanol del condensado por destilación.
15) Un microorganismo como se ha definido en cualquiera de las reinvindicaciones 1 a 12.
RESUMEN
Procedimiento para la producción biológica de n-Butanol con alto rendimiento
La presente invención suministra un método para la producción biológica de n-butanol con alto rendimiento a partir de una fuente de carbono fermentable. En un aspecto de la presente invención, se logra un procedimiento para la conversión de glucosa a n-butanol mediante el uso de un organismo recombinante que comprende un huésped C. acetobutlicum transformado i) para eliminar la vía del butirato ii) para eliminar la vía de la acetona iii) para eliminar la vía del lactato y iv) para eliminar la vía del acetato. En otro aspecto de la presente invención, el flujo de hidrógeno se decrementa y el poder reductor se redirecciona a la producción de n-butanol al atenuar la expresión del gen de la hidrogenasa. Opcionalmente, el n-butanol producido puede ser eliminado durante la fermentación por stripping gaseoso y, a continuación, purificado por destilación.
Spanish to English: JOSE GAMARRA. "SENDEROS”, (“PARCOURS”) General field: Art/Literary Detailed field: Art, Arts & Crafts, Painting
Source text - Spanish JOSE GAMARRA
“SENDEROS”
(“PARCOURS”)
Exposición realizada en la
Galerie Municipale Julio Gonzalez
21, Av. Paul Doumer
94110 ARCUEIL, Francia
7 de noviembre al 6 de diciembre 2008
La exposición “Senderos” (“Parcours”) reúne las obras de diversos períodos pictóricos del artista José Gamarra. Abarca dibujos –realizados a la edad de once años– seguidos por obras de su primera época, que representan símbolos precolombinos presentados bajo la forma de diaporamas sobre pantallas de video, hasta las pinturas de paisajes amazónicos más actuales, realizadas en formato grande.
Nacido en 1934 en Tacuarembó, Uruguay, desde sus primeros años José Gamarra se apasiona por el dibujo y la pintura. Realiza su primera exposición antes de haber cumplido los trece años. En 1959, obtiene una beca del gobierno brasileño para iniciar estudios de grabado en Río de Janeiro. Instalado en San Pablo, realiza sus estudios en el Museo de Arte Moderno y participa en la IIIa Bienal de Jóvenes Pintores de París, donde obtiene una beca. Posteriormente, se instala en Francia junto con su esposa Dilma, en el año 1963. Luego, los Gamarra hacen repetidos viajes de ida y vuelta entre Francia y su país natal… pero ya no dejarán Europa. Debe notarse que en aquella época, existía una comunicación y un intercambio de información realmente dinámico entre Francia y el continente latinoamericano.
“Desde París, podíamos ver toda la América Latina”, nos dice Gamarra. “El medio artístico en Francia era muy atrayente, añade Dilma, y por otro lado, era como una especie de desafío que uno se planteaba a sí mismo. Para José Gamarra, era esencial medirse (en el sentido de tomar conciencia de su propia valía) contra los pintores del mundo entero que trabajaban en París”.(L’Humanité, diciembre 1992). Las dos primeras exposiciones de José Gamarra en Francia tuvieron lugar en 1966, en la Galería Péron y, en 1976, en la Galería L’œil de Bœf (El ojo de Buey).
Al principio, en su taller a cielo abierto, instalado en plena selva amazónica, el pintor trabajaba en grandes telas monocromáticas realizadas totalmente en materia, que adornaba con signos y símbolos precolombinos. Más tarde, cuando comenzó a trabajar sobre superficies planas y lisas, su paleta se enriqueció con colores múltiples y con camafeos de color verde propios de sus paisajes ecuatoriales.
En la pintura de Gamarra, lo que llama poderosamente la atención es la precisión de su pincelada. El denticulado –hasta la nervadura misma de cada hoja- es una prueba de una minuciosidad suntuosa. La pintura de Gamarra no es amanerada, sino que es precisa y detallada. El artista se vale de la pintura al óleo, que mezcla con resinas, cola y vinilos. Su taller es su laboratorio, no sólo porque ama experimentar con las diversas mezclas de pigmentos, sino porque debido a todas las colecciones y a las investigaciones que realiza sobre el continente latinoamericano en su conjunto, es como un científico descubridor de nuevas especies y taxonomías. Su búsqueda engloba tanto a la zoología como la botánica, la geografía o la historia. Este conocimiento de la flora, de la fauna y de la historia de América Latina se adivina tras la riqueza deslumbrante de sus paisajes y de los diferentes temas que aparecen en sus pinturas.
En Gamarra, el paisaje descubre un abanico de períodos históricos. Para él, la selva revela diversas influencias culturales, así como el choque de las civilizaciones. Aparecen pequeños personajes, como por encanto, dentro una maraña de lianas y hojas en medio de grandes árboles frondosos. Personajes-testigo de épocas pasadas, pero también de una historia que aún está signada por la barbarie: muchas han sido las colonizaciones que ha debido sufrir América Latina… La aparición de estos pequeños personajes otorga a sus cuadros un aspecto mágico; sin embargo, no se puede hablar de ingenuidad. Gamarra no es un Douanier-Rousseau uruguayo. Por el contrario, su pintura posee una fuerte conciencia histórica. Es así que en Gamarra, la selva tiene connotaciones políticas. Es “invasora”, envuelve a los individuos en su seno. Los personajes de Gamarra son casi miniaturas, como si la naturaleza retomara sus derechos y sus pasos por encima de la cultura. Cada personaje está cargado de un simbolismo muy preciso. José Gamarra trata de hacer un relato de la evolución dentro de un paisaje latinoamericano.
“La estructura del catálogo de símbolos [de José Gamarra] obedece a leyes profundas: la mezcla del pasado con el presente, de lo orgánico con lo industrial, de lo subterráneo con lo aéreo. Es así que descubrimos la sangre-petróleo, la bestia-matriz, el ángel-helicóptero, el navío-fauces, la serpiente-paracaídas. Todos los componentes de la larga pasión del continente sudamericano, entre los perros cazadores y las bombas, tan mortíferas como las perforaciones mineras.”
(Edouard Glissant, 1985)
José Gamarra no busca hacer anacronismos: confronta diversos períodos históricos dentro de un mismo cuadro. Su selva sirve “tanto como caverna, tanto como pantalla”, develando una historia en forma de mosaico. No se puede entender la historia contemporánea sin estas capas sucesivas de despojos del pasado. La obra de Gamarra nos hace reflexionar sobre la noción de identidad. La persistencia del pasado en el presente queda como testigo de una identidad en perpetuo devenir. La identidad cultural está marcada por influencias, mestizajes, hibridaciones técnicas y científicas, e intrusiones –a veces violentas- en su propia historia, en su propia subjetividad, o en la del país. Los mitos y relatos fundadores, los héroes de leyenda, tales como las sirenas o San Jorge que abate al dragón, se mezclan aquí con las representaciones del simbolismo propio del pintor, tales como la anaconda, que representa el imperialismo del poder americano. La identidad no aparece como algo fijo, sino que es evolutiva y conserva su parte de singularidad. En Gamarra, hasta los símbolos y los mitos están en un proceso de perpetua mutación y reinvención.
Los dualismos que dejan traslucir los cuadros de Gamarra, tales como los de la Naturaleza/cultura, arcaísmo/modernidad-progreso, se vuelven difusos y se funden para formar un todo. Aquí, la modernidad tiene cara de jeep, de helicóptero, de militares, de la era industrial, pero no logran borrar al Indio con su arco, a la piragua, al pájaro quetzal. Las singularidades culturales perduran. Ninguna violencia, ya sea política o militar, ningún genocidio, podrá aniquilar las huellas y los restos de una cultura. A pesar de todo, la civilización se mezcla aquí con la barbarie y la explotación de las riquezas. En este sentido, los pequeños personajes de Gamarra mezclan lo fantástico con una tensión opresiva…
Uno se podría preguntar si los sujetos pictóricos de Gamarra no revelan un primitivismo idealizado, la figura del “buen salvaje” frente a la del colonizador, y no constituyen una prueba de un paraíso perdido. Sin embargo, el juego que describen es bastante más sutil. El guerrillero ¿no podrá ser también el sacerdote que ha tomado las armas para luchar al lado de los indios? ¿No se habrán pasado algunos militares del lado de los oprimidos? A pesar de estas excepciones, la historia, en gran parte, no es más que una historia de dominación. José Gamarra nos hace ver sus contradicciones y sus paradojas. Son dos mundos se enfrentan. Por una parte, está la naturaleza o el caballo blanco, símbolo de libertad, que tiene deseos de piafar y de brincar libremente, mientras que por otra, están los diferentes poderes que sustentan la estructura del mundo: el dinero, las ganancias, las posesiones y el poder político, sinónimos de amenaza y agresión… La pintura de José Gamarra es un himno a la libertad, es una denuncia contra toda forma de opresión: desde los conquistadores españoles hasta las empresas multinacionales modernas. La civilización se trasluce en la naturaleza con elementos y sujetos casi miniaturistas que se enfrentan en el combate del siglo XXI por la preservación de nuestro patrimonio mundial.
Ilustraciones:
La Lluvia
1991-1992
Óleo sobre tela
100 x 81 cm
Colección privada,
París
En la cubierta
El paraíso inaccesible
(Inaccesible eden)
1986-1987
Óleo sobre tela
150 x 200 cm
Colección privada
Birmingham
Michigan,
EE.UU.
Icaro (Icare)
1986-87
Técnica mixta
Sobre tela
265 x 200 cm
Colección privada
Birmingham
Michigan,
EE.UU.
Murmullos en la Selva
1995-97
Técnica mixta
Sobre tela
230 x 295 cm
Colección privada,
París.
José Gamarra
ha realizado más
de cincuenta
exposiciones individuales
y ha participado en
numerosas exposiciones
en todos los continentes.
Biografía abreviada
1934 Nace en Tacuarembó, Uruguay. Asiste a la escuela primaria, donde el aprendizaje artístico ocupa un lugar importante.
1947 Primera exposición individual en las prestigiosas salas del Ateneo de Montevideo.
1952-59 Estudios de pintura y grabado en la Escuela de Bellas Artes de Montevideo.
1953 Sucesivos viajes a través de la cuenca del Amazonas.
1959-1960 Beca “Itamarati”: estudios de grabado en el Museo de Arte Moderno de Rio de Janeiro y en el Instituo de Bellas Artes de Praia Vermelha. Primera exposición personal en Brasil. Participación en Salones de Pintura.
1960 Se instala en San Pablo. Profesor de pintura y de frescos en la Escuela de Arte de la Fundación Armando Alvarez Penteado (3 años). Varios viajes a Uruguay y Argentina. Numerosas exposiciones colectivas en galerías, bienales y museos internacionales de América del Sur, los EE.UU. y Europa.
1962 Premio de pintura en la “Bienal Ameriana de Arte”, Córdoba, Argentina y en el XI Salon Paulista de Arte Moderno, San Pablo.
1963 Primer premio de la “Bienal de Jóvenes de Montevideo” (Viaje a Europa). Premio a la Pintura y beca de la III Biennale des Jeunes de Paris. Arribo a la ciudad de Arcueil, Francia, donde vive y trabaja durante 35 años en la vieja Maison Raspail.
1964 Representa a Uruguay en la Bienal de Venecia. Exposiciones colectivas
y salones en Francia.
1966 Viaje y estadía de dos meses en Nueva York. Obtiene el Premio al Grabado “Posadas” en La Habana. Viaje a Cuba. Primera exposición en París en la Galería Péron.
1967 En Paris, obtiene el Premio Arnys, Premio a la Pintura Joven.
1972 Viaje a Uruguay.
1980 Primer viaje a Caracas. Miembro fundador del Espacio Latino-Americano en París. Viaje a Italia y a Bulgaria.
1981 Premio de pintura y medalla de plata en el Salón de Montrouge, Francia. Viaje a La Habana.
1982 Viaje a Venezuela.
1983 Viaje a España. Exposición de las “Capitulaciones”, Santa Fé de Granada. El Museo Metropolitano de Nueva York adquiere su cuadro “Urutaú”.
1984 Obtiene el premio de pintura “Cándido Portinari” en la Bienal de La Habana. Viaje a Cuba.
1985 Luego de catorce años de ausencia, viaja a Uruguay, adonde luego regresa regularmente, así como a Argentina y a Brasil.
1987 Seleccionado para integrar “The Art of the Fantastic: Latin America 1920-
1987”, Museo de Arte de Indianápolis.
1989 Realiza un fresco para la ciudad de Arcueil, a pedido de la municipalidad. Seleccionado para “Art in Latin America – The Modern Era 1820-1980”, Hayward Gallery, Londres y National Museum y Moderna Muséet, Estocolmo.
1990 Viaje a Caracas, exposición individual.
1992 Integra la exposición “Pintura Latinoamericana del Siglo XX”, Instituto de América, Santa Fe de Granada. Seleccionado para integrar “L’Art d’Amerique Latine” en el Centro Pompidou en ocasión del 50º centenario del descubrimiento de América.
1999 Integra la exposición “Ironie et nostalgia dans l’Ecoe de Paris – L’Adieu au Siecle”, Museo de Villach, Carinthie, Austria.
2000 Figuras del Laberinto, FIA-Caracas (Galería Minotauro).
2001 Miami’ 2001 (Galería Minotauro de Caracas).
2003 Wilfredo Lam – Agustín Cárdenas – José Gamarra. Galerie Albert Loeb, Paris.
2004 “Peintres de Paris”. National Taiwan Museum of Fine Arts, Taiwán.
2007 “Imaginarios prehispánicos en el Arte Uruguayo”. Museo de Arte Precolombino e Indígena, Montevideo.
2008 FIA – Caracas, Galería Minotauro. Feria ArteBa, Buenos Aires, Argentina. Feria de Basilea. “20th Century Latin American Art”, National Museum of Contemporary Art, Deksugung, Seúl, Corea. Latin American Artists Shanghai Art Fair.
COLECCIONES PUBLICADAS
(escanear)
Translation - English JOSE GAMARRA
“PATHS”
(“PARCOURS”)
Exhibition held at
Galerie Municipale Julio González
21, A. Paul Doumer
November 7 – December 6, 2008
The Exhibition “Paths” (“Parcours”) displays the collected works of various periods of José Gamarra’s life as a painter. They include the drawings made by Gamarra when he was only eleven years old; the works of the artist’s early period -representing pre-Columbian symbols presented as diaporamas on video screens; and some of the later paintings, depicting Amazonian landscapes, rendered in a large format.
Gamarra was born in 1934 in Tacuarembó, Uruguay. As a child, he loved drawing and painting. Actually, the first exhibition of his paintings was made before he was thirteen years old. In 1959 he obtained a scholarship from the Brazilian government to take engraving lessons in Rio de Janeiro. Subsequently, he moved to Sao Paulo, where he studied at the Museum of Modern Art and participated in the III Biennial of Young Painters held in Paris, where he obtained a scholarship. In 1963, he moved to France together with his wife Dilma. The Gamarras made repeated trips between France and their native country, but they never left Europe. We should note that at that time, a fluent communication and exchange of information existed between France and Latin American countries.
“From Paris, we had a view of all Latin America”, says Gamarra. And Dilma adds: “Artistic life in France was very attractive and, on the other hand, it represented a challenge. For José Gamarra, it was essential to take his own measure against other worldwide painters currently working in Paris – it was a way of estimating his own worth as an artist. (L’Humanité, December 1992). Gamarra’s first two exhibitions in France were held in 1966, at the Galerie Pèron and in 1976, at the Galerie L’œil de Bœf.
At first, in his open-air studio in the middle of the Amazonian jungle, the painter worked in large monochromatic canvases totally made of matter, ornamented with signs and pre-Columbian symbols. Later, when he changed to smooth, flat surfaces, his palette became richer, with varied colors and cameo-like greens, typical of equatorial landscapes.
The most distinctive trait in Gamarra’s works is the precision of his brush stroke. An example of this is his outstanding skill for sumptuously depicting minute details, such as the dented pattern –even the nervures- of a leaf. However, there are no traces of mannerism in his paintings: his works are rendered with a precise and detailed craftsmanship. The artist resorts to oil, mixed with resins, glue and vinyl. His studio is his laboratory, not only because he loves to experiment with new pigment mixtures, but also because of all the items collected and investigations made with regard to the Latin American continent in general. He is like a scientist discovering new species and taxonomies. His research covers zoology and botany, geography and history. His knowledge of the Latin American flora, fauna and history is visible in the striking richness pervading his landscapes and different pictorial subjects.
In Gamarra, the landscape evokes a large range of historical periods. The jungle reveals different cultural influences, as well as the clash of civilizations. As if by magic, small characters appear, amid an entanglement of creeping vines, leaves and huge, luxuriant trees. These are the characters/witnesses of past times, but also of a story still signaled by cruelty: Latin America has suffered from many colonizations… The apparition of these small characters gives a magic aspect to his paintings. However, there is no naiveté in them. Gamarra is not an Uruguayan Douanier-Rousseau. On the contrary, his works reflect a strong historical awareness. For Gamarra, the jungle has political connotations. It is “invasive”; it enfolds individuals. Gamarra’s’s characters are almost miniatures, as if Nature regained its rights and stepped over culture. Each character is charged with a very precise symbolism. Gamarra tries to narrate the story of evolution within a Latin American landscape.
“The structure of [José Gamarra’s] symbolic language is in line with deep-rooted laws: it is the blend of the past with the present; of the organic with the industrial; of the underground with the aerial elements. Thus, we discover the blood-petroleum; the beast-uterus; the angel-helicopter; the ship-gullet; the snake-parachute. All the components of the long, tragic story of the South American continent are present, amid chasing dogs and bombs, deadly as the mineral mines.”
(Edouard Glissant, 1985)
José Gamarra is not looking for anachronisms: he confronts several historical periods within the same painting. His jungle works “both as a cavern, and as a screen”, revealing a story in mosaic form. One cannot understand contemporary history without these successive layers of spoils from the past. Gamarra’s work leads us to reflect on our notion of identity. The persistence of the past within the present is the witness of an ever-changing identity. Cultural identity is marked by influences, by crossbreeding, by technical and scientific hybridizing and by occasionally violent intrusions in its own history, in its individual or the country’s subjectivity. Myths and old founding stories, legendary heroes such as the mermaids or Saint George vanquishing the dragon, blend with the artist’s own imagery, such as the anaconda, representing American imperialism. Identity is not a fixed element, but it is subject to constant evolution while maintaining its individuality. In Gamarra, even symbols and myths are subject to a process of perpetual mutation and re-invention.
In Gamarra’s paintings, dualism is always present. Thus, Nature/culture; archaism/modernity and progress, become diffuse and blend to become a whole. In his pictures, modernity may take the aspect of a jeep, of a helicopter, of the military, of the industrial age; however, these cannot erase the Indian with his bow, the canoe, the quetzal bird. Cultural singularities persist. No violence, be it political or military, no genocide, will be capable of obliterating the traces and the remains of a culture. In spite of this, civilization is tainted with cruelty and with the exploitation of resources. Gamarra’s small characters combine a fantastic world with a feeling of oppression…
One may ask if Gamarra’s pictorial subjects are not revealing a sort of idealized primitivism, the figure of the “good savage”, vis-à-vis that of the colonizer; whether they represent an evidence of the lost paradise. However, these characters propose a subtler game. Could not the guerrilla be the priest who has taken arms in order to fight along with the Indians? Have some of the soldiers defected, in order to fight for the oppressed? In spite of these exceptions, history is mainly a story of domination. José Gamarra reveals its contradictions and paradoxes. Two worlds confront one another. On the one hand, there is Nature or the white horse -a symbol of freedom- wishing to stamp its feet and run free and, on the other, the different powers that support the world’s structure: money, earnings, possessions and political power, synonyms of threats and aggressions… Jose Gamarra’s works are a hymn to freedom, a denunciation against all forms of oppression, be it the Spanish conquistadores or the modern multinational companies. Civilization shines through in Nature, with elements and almost miniature individuals that confront one another in the 20th century’s combat for the preservation of our world’s patrimony.
Illustrations:
Rain (La Lluvia)
1991-1992
Oil on canvas
100 x 81 cm
Private collection
Paris
(cover)
Inaccesible Eden (El paraíso inaccessible)
1986-1987
Oil on canvas
150 x 200 cm
Private collection
Birmingham
Michigan,
U.S.A.
Icarus (Icare)
1986-87
Mixed technique
on canvas
265 x 200 cm
Private collection
Birmingham
Michigan,
U.S.A.
Whispers in the Jungle (Murmullos en la selva)
1995-97
Mixed technique
on canvas
230 x 295 cm
Private collection,
Paris.
José Gamarra has held over
fifty individual exhibitions
and has participated in
many exhibitions
in every continent.
Brief Biography
1934 Born in Tacuarembó, Uruguay. Attends elementary school, where the teaching of art plays an important place in children’s education.
1947 First individual exhibition at the exclusive hall of the Ateneo de Montevideo.
1952-59 Takes painting and engraving lessons at the Escuela de Bellas Artes de Montevideo.
1953 Successive trips along the Amazonas river basin.
1959-1960 Receives “Itamarati” scholarship: takes engraving lessons at the Museo de Arte Moderno de Rio de Janeiro y at the Institute of Fine Arts of Praia Vermelha. First individual exhibition in Brazil. Participates in Painting Salons.
1960 Moves to Sao Paulo. Teaches painting and fresco at the School of Arts of the Armando Alvarez Penteado Foundation (3 years). Takes repeated trips to Uruguay and Argentina. Holds many collective exhibitions at galleries, Biennials and international museums in South America, the U.S.A. and Europe.
1962 Receives Painting Award at the “Bienal Americana de Arte”, Córdoba, Argentina and at the XI Salon Paulista de Arte Moderno, Sao Paulo.
1963 Receives First Prize at the “Bienal de Jóvenes de Montevideo” (a trip to Europe). Receives Painting Award and a scholarship at the III Biennale des Jeunes de Paris. Arrival in Arcueil, France, where he lives and works for 35 years, at the old Maison Raspail.
1964 Represents Uruguay at the Biennial of Venice. Participates in collective exhibitions and Salons in France.
1966 Trip and two-months’ stay in New York. Obtains the “Posadas” Engraving Prize in La Habana. Trip to Cuba. First exhibition in Paris, at the Galerie Pèron.
1967 Obtains the Arnys Prize in Paris, the Young Painters Award.
1972 Travels to Uruguay.
1980 First trip to Caracas. Founding Member of the Espacio Latino-Americano in París. Travels to Italy and Bulgaria
1981 Painting Award and Silver Medal at the Salón de Montrouge, France. Travels to Havanna.
1982 Trip to Venezuela.
1983 Trip to Spain. “Capitulaciones” Exhibition, Santa Fé de Granada. The Metropolinan Museum of New York acquires his painting “Urutau”.
1984 Obtains the “Cándido Portinari” Award at the Bienal de La Habana. Trip to Cuba.
1985 After a fourteen years’ absence, he returns to Uruguay; then, he takes regular trips to Uruguay, Argentina and Brazil
1987 Selected to participate in “The Art of the Fantastic: Latin America 1920-
1987”, Indianapolis Museum of Arts.
1989 Makes a fresco for Arcueil, at the municipality’s request. Selected for “Art in Latin America – The modern Era 18201980”, Hayward Gallery, London and National Museum and Moderna Muséet, Stockholm.
1990 Trip to Caracas, one-man show.
1992 Integrates the exhibition “Pintura Latinoamericana del Siglo XX”, Instituto de América, Santa Fe de Granada. Selected to integrate the exhibition “L’Art d’Amerique Latine” at the Centre Pompidou, on the occasion of the 50th centenary of the discovery of America.
1999 Participates in the exhibition “Ironie et nostalgia dans l’Ecole de Paris – L’Adieu au Siecle”, Villach Museum, Carinthie, Austria.
2000 Figuras del Laberinto, FIA-Caracas (Galería Minotauro).
2001 Miami’ 2001 (Galería Minotauro de Caracas).
2003 Wilfredo Lam – Agustín Cárdenas – José Gamarra. Galerie Albert Loeb, Paris.
2004 “Peintres de Paris”. National Taiwan Museum of Fine Arts, Taiwan.
2007 “Imaginarios prehispánicos en el Arte Uruguayo”. Museo de Arte Precolombino e Indígena, Montevideo.
2008 FIA – Caracas, Galería Minotauro. Feria ArteBa, Buenos Aires, Argentina. Basle’s Art Fair. “20th Century Latin American Art”, National Museum of Contemporary Art, Deksugung, Seul, Corea. Latin American Artists Shanghai Art Fair.
COLECCIONES PUBLICADAS
(scan)
More
Less
Translation education
Other - London School Certificate, Cambridge school Certificate, Diplome de Capacité in French, Alliance Francaise, Chem.Eng..
Experience
Years of experience: 56. Registered at ProZ.com: Aug 2003.
English to Spanish (Chem.Eng. Facultad de Química Uruguay) English to Spanish (Quality Assurance, UNIT Uruguay) English to Spanish (Geology and minerals Fac. de Quím. Uruguay) English to Spanish (Modern analitical techniques, Hewlett-Packard) English to Spanish (Pesticides, FAO project, Australia)
English to Spanish (Modern Administrative practices. Servicio Civil Ur) English to Spanish (British Schools of Uruguay) Spanish to English (London School Certificate, General Certificate of )
More
Less
Memberships
N/A
Software
Adobe Acrobat, Adobe Illustrator, Adobe Photoshop, Frontpage, Microsoft Excel, Microsoft Word, Pagemaker, Powerpoint, Trados Studio
Area of expertise.
Translations: Research papers, technical documents, medical, pharmaceutical, chemical, engineering, mechanics and gene engineering. Translation of general interest articles.
Correction of proofs for publication purposes.
Translations of Power Point presentations, web presentations, Publisher and Pagemaker presentations.
Patents Translation of medical, pharmaceutical, chemical, chemical engineering, engineering and genetic engineering covering all steps prior to the filing of claims in Latin American countries.
Patent opposition research and lifting of observations.
Access to USPO, ES. EP, etc. and selected patent attorneys.
Patents conceded, patents pending, patents under study, patent viability.
Statistics: Longstanding experience in experimental design (ANOVA, Plakett and Burnam, Box Wilson, Winsurfer, etc.
Laboratory: Modern analytical techniques, nmr, gas chrom, HPLC, RIA, Storhher, etc.
Medicine: Personally developed an ELISA kit for the detection of animal protein based on Troponine-T extracted from suprarenal tissue.
Research: Created a mathematical model for stripping and the program used to control it.
Created four programs for the design of hydro dispersible formulations. Two in Spanish and two in English.
Designed and constructed two pilot plants for the extraction of essential oils.
Designed and constructed three pilot plants for smoking food. A fourth one fully automatic.
Electronics: Developed and constructed several electronic hydrophones with incorporated preamplifiers.
Developed and constructed 3 electronic percussion instruments simulating sea waves.
Ceramics: Expertise in ceramics having worked for 4 years in the Industry developing new products in the lab. Responsible for 27 pilot productions
This user has earned KudoZ points by helping other translators with PRO-level terms. Click point total(s) to see term translations provided.